ID: 1036457944

View in Genome Browser
Species Human (GRCh38)
Location 8:8925953-8925975
Sequence ACATCAACGAGGAAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457944_1036457950 -8 Left 1036457944 8:8925953-8925975 CCTCCACCCTTCCTCGTTGATGT No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457944_1036457951 20 Left 1036457944 8:8925953-8925975 CCTCCACCCTTCCTCGTTGATGT No data
Right 1036457951 8:8925996-8926018 AGATTTCTGTTCTTAGAAACAGG No data
1036457944_1036457952 28 Left 1036457944 8:8925953-8925975 CCTCCACCCTTCCTCGTTGATGT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457944 Original CRISPR ACATCAACGAGGAAGGGTGG AGG (reversed) Intergenic