ID: 1036457945

View in Genome Browser
Species Human (GRCh38)
Location 8:8925956-8925978
Sequence ATAACATCAACGAGGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457945_1036457952 25 Left 1036457945 8:8925956-8925978 CCACCCTTCCTCGTTGATGTTAT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457945_1036457951 17 Left 1036457945 8:8925956-8925978 CCACCCTTCCTCGTTGATGTTAT No data
Right 1036457951 8:8925996-8926018 AGATTTCTGTTCTTAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457945 Original CRISPR ATAACATCAACGAGGAAGGG TGG (reversed) Intergenic
No off target data available for this crispr