ID: 1036457947

View in Genome Browser
Species Human (GRCh38)
Location 8:8925960-8925982
Sequence CAGTATAACATCAACGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457947_1036457951 13 Left 1036457947 8:8925960-8925982 CCTTCCTCGTTGATGTTATACTG No data
Right 1036457951 8:8925996-8926018 AGATTTCTGTTCTTAGAAACAGG No data
1036457947_1036457953 28 Left 1036457947 8:8925960-8925982 CCTTCCTCGTTGATGTTATACTG No data
Right 1036457953 8:8926011-8926033 GAAACAGGAGAAAAGGAAGATGG No data
1036457947_1036457952 21 Left 1036457947 8:8925960-8925982 CCTTCCTCGTTGATGTTATACTG No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457947 Original CRISPR CAGTATAACATCAACGAGGA AGG (reversed) Intergenic
No off target data available for this crispr