ID: 1036457950

View in Genome Browser
Species Human (GRCh38)
Location 8:8925968-8925990
Sequence GTTGATGTTATACTGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457940_1036457950 5 Left 1036457940 8:8925940-8925962 CCATCTCTCTCCCCCTCCACCCT No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457943_1036457950 -7 Left 1036457943 8:8925952-8925974 CCCTCCACCCTTCCTCGTTGATG No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457942_1036457950 -6 Left 1036457942 8:8925951-8925973 CCCCTCCACCCTTCCTCGTTGAT No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457944_1036457950 -8 Left 1036457944 8:8925953-8925975 CCTCCACCCTTCCTCGTTGATGT No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457941_1036457950 -5 Left 1036457941 8:8925950-8925972 CCCCCTCCACCCTTCCTCGTTGA No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457950 Original CRISPR GTTGATGTTATACTGGATTT AGG Intergenic
No off target data available for this crispr