ID: 1036457952

View in Genome Browser
Species Human (GRCh38)
Location 8:8926004-8926026
Sequence GTTCTTAGAAACAGGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457946_1036457952 22 Left 1036457946 8:8925959-8925981 CCCTTCCTCGTTGATGTTATACT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457945_1036457952 25 Left 1036457945 8:8925956-8925978 CCACCCTTCCTCGTTGATGTTAT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457944_1036457952 28 Left 1036457944 8:8925953-8925975 CCTCCACCCTTCCTCGTTGATGT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457943_1036457952 29 Left 1036457943 8:8925952-8925974 CCCTCCACCCTTCCTCGTTGATG No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457942_1036457952 30 Left 1036457942 8:8925951-8925973 CCCCTCCACCCTTCCTCGTTGAT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457949_1036457952 17 Left 1036457949 8:8925964-8925986 CCTCGTTGATGTTATACTGGATT No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457947_1036457952 21 Left 1036457947 8:8925960-8925982 CCTTCCTCGTTGATGTTATACTG No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457952 Original CRISPR GTTCTTAGAAACAGGAGAAA AGG Intergenic
No off target data available for this crispr