ID: 1036457953

View in Genome Browser
Species Human (GRCh38)
Location 8:8926011-8926033
Sequence GAAACAGGAGAAAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457946_1036457953 29 Left 1036457946 8:8925959-8925981 CCCTTCCTCGTTGATGTTATACT No data
Right 1036457953 8:8926011-8926033 GAAACAGGAGAAAAGGAAGATGG No data
1036457947_1036457953 28 Left 1036457947 8:8925960-8925982 CCTTCCTCGTTGATGTTATACTG No data
Right 1036457953 8:8926011-8926033 GAAACAGGAGAAAAGGAAGATGG No data
1036457949_1036457953 24 Left 1036457949 8:8925964-8925986 CCTCGTTGATGTTATACTGGATT No data
Right 1036457953 8:8926011-8926033 GAAACAGGAGAAAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457953 Original CRISPR GAAACAGGAGAAAAGGAAGA TGG Intergenic
No off target data available for this crispr