ID: 1036458226

View in Genome Browser
Species Human (GRCh38)
Location 8:8928234-8928256
Sequence CTGAATATGTAGAAATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036458223_1036458226 -10 Left 1036458223 8:8928221-8928243 CCCATCACGTATGCTGAATATGT No data
Right 1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036458226 Original CRISPR CTGAATATGTAGAAATTGGA TGG Intergenic
No off target data available for this crispr