ID: 1036461814

View in Genome Browser
Species Human (GRCh38)
Location 8:8960142-8960164
Sequence AGAAGTTCGCTGCAGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036461814_1036461820 -8 Left 1036461814 8:8960142-8960164 CCCCACACCTGCAGCGAACTTCT No data
Right 1036461820 8:8960157-8960179 GAACTTCTGCCTGGGCATCCAGG No data
1036461814_1036461824 20 Left 1036461814 8:8960142-8960164 CCCCACACCTGCAGCGAACTTCT No data
Right 1036461824 8:8960185-8960207 CCTTACGTCCTCTGAAATCTAGG No data
1036461814_1036461825 23 Left 1036461814 8:8960142-8960164 CCCCACACCTGCAGCGAACTTCT No data
Right 1036461825 8:8960188-8960210 TACGTCCTCTGAAATCTAGGAGG No data
1036461814_1036461826 26 Left 1036461814 8:8960142-8960164 CCCCACACCTGCAGCGAACTTCT No data
Right 1036461826 8:8960191-8960213 GTCCTCTGAAATCTAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036461814 Original CRISPR AGAAGTTCGCTGCAGGTGTG GGG (reversed) Intergenic
No off target data available for this crispr