ID: 1036465232

View in Genome Browser
Species Human (GRCh38)
Location 8:8991296-8991318
Sequence GGAAAGACAGAAACAGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036465232_1036465243 29 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465243 8:8991348-8991370 GTGTCTGGAACATGGGAATGAGG No data
1036465232_1036465240 14 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG No data
1036465232_1036465239 7 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465239 8:8991326-8991348 GAACGGTGTGTGAAATGGGGAGG No data
1036465232_1036465241 21 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465241 8:8991340-8991362 ATGGGGAGGTGTCTGGAACATGG No data
1036465232_1036465242 22 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465242 8:8991341-8991363 TGGGGAGGTGTCTGGAACATGGG No data
1036465232_1036465237 3 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465237 8:8991322-8991344 GGCTGAACGGTGTGTGAAATGGG No data
1036465232_1036465234 -10 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465234 8:8991309-8991331 CTGTCTTTCCATTGGCTGAACGG No data
1036465232_1036465238 4 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465238 8:8991323-8991345 GCTGAACGGTGTGTGAAATGGGG No data
1036465232_1036465236 2 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465236 8:8991321-8991343 TGGCTGAACGGTGTGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036465232 Original CRISPR GGAAAGACAGAAACAGTAAA AGG (reversed) Intergenic
No off target data available for this crispr