ID: 1036465235

View in Genome Browser
Species Human (GRCh38)
Location 8:8991317-8991339
Sequence TTCACACACCGTTCAGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036465235_1036465242 1 Left 1036465235 8:8991317-8991339 CCATTGGCTGAACGGTGTGTGAA No data
Right 1036465242 8:8991341-8991363 TGGGGAGGTGTCTGGAACATGGG No data
1036465235_1036465244 21 Left 1036465235 8:8991317-8991339 CCATTGGCTGAACGGTGTGTGAA No data
Right 1036465244 8:8991361-8991383 GGGAATGAGGACAGCATACTAGG No data
1036465235_1036465240 -7 Left 1036465235 8:8991317-8991339 CCATTGGCTGAACGGTGTGTGAA No data
Right 1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG No data
1036465235_1036465241 0 Left 1036465235 8:8991317-8991339 CCATTGGCTGAACGGTGTGTGAA No data
Right 1036465241 8:8991340-8991362 ATGGGGAGGTGTCTGGAACATGG No data
1036465235_1036465243 8 Left 1036465235 8:8991317-8991339 CCATTGGCTGAACGGTGTGTGAA No data
Right 1036465243 8:8991348-8991370 GTGTCTGGAACATGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036465235 Original CRISPR TTCACACACCGTTCAGCCAA TGG (reversed) Intergenic
No off target data available for this crispr