ID: 1036465240

View in Genome Browser
Species Human (GRCh38)
Location 8:8991333-8991355
Sequence GTGTGAAATGGGGAGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036465232_1036465240 14 Left 1036465232 8:8991296-8991318 CCTTTTACTGTTTCTGTCTTTCC No data
Right 1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG No data
1036465231_1036465240 15 Left 1036465231 8:8991295-8991317 CCCTTTTACTGTTTCTGTCTTTC No data
Right 1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG No data
1036465230_1036465240 18 Left 1036465230 8:8991292-8991314 CCTCCCTTTTACTGTTTCTGTCT No data
Right 1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG No data
1036465235_1036465240 -7 Left 1036465235 8:8991317-8991339 CCATTGGCTGAACGGTGTGTGAA No data
Right 1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036465240 Original CRISPR GTGTGAAATGGGGAGGTGTC TGG Intergenic
No off target data available for this crispr