ID: 1036466557

View in Genome Browser
Species Human (GRCh38)
Location 8:9003114-9003136
Sequence GCTGCTGGAGTCGCCGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036466552_1036466557 3 Left 1036466552 8:9003088-9003110 CCTGCCGGCGAGGCCGTGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 290
1036466555_1036466557 -10 Left 1036466555 8:9003101-9003123 CCGTGGCTCTCGCGCTGCTGGAG 0: 1
1: 0
2: 0
3: 19
4: 148
Right 1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 290
1036466548_1036466557 18 Left 1036466548 8:9003073-9003095 CCACAGAGTAAAGAGCCTGCCGG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 290
1036466553_1036466557 -1 Left 1036466553 8:9003092-9003114 CCGGCGAGGCCGTGGCTCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036466557 Original CRISPR GCTGCTGGAGTCGCCGCGGC CGG Exonic
900005983 1:51752-51774 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
900148073 1:1166953-1166975 GCTGCTGGACTCGGCAGGGCTGG + Intergenic
900298799 1:1966275-1966297 GCAGCTGGTGTGGCCGGGGCAGG + Intronic
901042290 1:6372114-6372136 GCTGCTGGAGAAGCTGCAGCAGG - Intronic
901514406 1:9735277-9735299 GTTCCTGGAGTGGCCCCGGCAGG - Intronic
901870989 1:12139164-12139186 GCTGCTGGAGGCTTCTCGGCAGG - Intronic
902447383 1:16475953-16475975 GCGGCTGGAGGCGCTGCGGTTGG - Intergenic
902732483 1:18378332-18378354 CCTGATGGAGTGGCCGGGGCGGG - Exonic
903039498 1:20518091-20518113 GCTACTGGAGACGCTGAGGCAGG + Intergenic
903077888 1:20786591-20786613 GCTGCTTCCGTCGCCGGGGCGGG - Intronic
903157816 1:21460116-21460138 GCTGCTGGGGCCGCCTGGGCTGG + Intronic
903232599 1:21931185-21931207 GCTGCTGGGGTGGCCGGGTCGGG - Intronic
904006594 1:27366327-27366349 GCTGCGGGGGCGGCCGCGGCCGG + Exonic
904159541 1:28512904-28512926 GCTGCTGGGGACGCTGAGGCAGG - Intronic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
906152629 1:43596383-43596405 GCTGCTGAAGTCCCCATGGCAGG + Intronic
906199509 1:43950022-43950044 GCAGCTGGAGGTGCCGCTGCAGG + Exonic
912796097 1:112694510-112694532 GGTGCTGGACTCGCAGCGGCTGG - Exonic
913544401 1:119853269-119853291 GCTGCTGGGGCCGCCTGGGCTGG - Intergenic
913602399 1:120434104-120434126 GCTGCTGGGGCCGCCTGGGCTGG + Intergenic
913991785 1:143620052-143620074 GCTGCTGGGGCCGCCTGGGCTGG - Intergenic
914190659 1:145407699-145407721 GCTGCTGGGGCCGCCTGGGCTGG - Intergenic
914363572 1:146957710-146957732 GCTGCTGGGGCCGCCTGGGCTGG + Intronic
914488105 1:148129424-148129446 GCTGCTGGGGCCGCCTGGGCTGG - Intronic
914588466 1:149084543-149084565 GCTGCTGGGGCCGCCTGGGCTGG - Intronic
917325390 1:173826110-173826132 GCTGCTGGGGAGGCCGAGGCAGG + Intronic
918883832 1:190164700-190164722 CCTGCTGGAGTGGACGAGGCCGG - Intronic
920361449 1:205419574-205419596 GCTGCTGGAGGGGCTGAGGCCGG - Intronic
921052249 1:211518913-211518935 GCTCCTGGAGCCACCGTGGCTGG + Intergenic
921891318 1:220356802-220356824 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
923662414 1:235969642-235969664 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
923708651 1:236367339-236367361 GCTACTGGAGAGGCCGAGGCAGG - Intronic
924624500 1:245687836-245687858 GCTGCTGGTGCCGCTGCCGCTGG - Exonic
924723342 1:246644275-246644297 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1064442983 10:15370672-15370694 GCTGCTGTCGCCGCTGCGGCGGG - Intronic
1068910524 10:62374420-62374442 GCTGCTGCAGCCGCCGCCTCCGG - Exonic
1069305888 10:66968903-66968925 GCTGCTGGGGGCGCTGAGGCAGG + Intronic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1069942434 10:71964671-71964693 GCCGGTGGAGTCTCGGCGGCCGG + Exonic
1072656495 10:97334029-97334051 GCTGCTGGAGGAGCCGATGCGGG + Exonic
1072750523 10:97975306-97975328 GCTGCGGGAGGCGCCAGGGCCGG + Intronic
1074405980 10:113180794-113180816 GCTGCTGGAGTCCCATCGGGGGG + Intergenic
1075126581 10:119705241-119705263 GCTGCTTGAGAGGCCGAGGCAGG - Intergenic
1076553541 10:131304936-131304958 GCTGCTGGAGGAGACGTGGCAGG - Intronic
1076694276 10:132239648-132239670 GCTGCTGCAGTCACTGCGGGCGG - Intronic
1076718883 10:132384018-132384040 GCTGCTGGAGGCCCTGGGGCAGG - Intergenic
1076821162 10:132940433-132940455 AGTGCTGGAGTCGCCTCCGCAGG + Intronic
1077094381 11:793123-793145 GCTGCTGCAGTGGCGGAGGCTGG - Intronic
1077198813 11:1295319-1295341 GCAGCTGGAGGAGGCGCGGCCGG - Intronic
1077637747 11:3855324-3855346 GCTGCTGTCGCCGCCGCCGCAGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078685026 11:13521483-13521505 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1080387145 11:31816892-31816914 GCAGCTGGAGACGCCCAGGCCGG - Intronic
1080746032 11:35109477-35109499 ACTGCTGGAGTCGAAGCAGCTGG - Intergenic
1081447324 11:43143336-43143358 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1083772980 11:64878670-64878692 GCGGCTAGCGCCGCCGCGGCGGG + Exonic
1084957046 11:72697118-72697140 GCTGCTGGAGAGCCTGCGGCAGG - Exonic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1086101996 11:83110514-83110536 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1089221823 11:116878489-116878511 GCTGCTGGAGAAGCTGAGGCAGG - Intronic
1089324691 11:117649187-117649209 GCTGCTGGGGTGGCTGAGGCAGG - Intronic
1090037607 11:123262361-123262383 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1090329745 11:125921775-125921797 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1092583377 12:9872826-9872848 GCTGCAGGCGTGGCGGCGGCAGG - Intergenic
1096314974 12:50556652-50556674 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1096466187 12:51848686-51848708 GCTGCTGCGGCCGCCGCGGGCGG + Intergenic
1096499951 12:52058698-52058720 GCTGCAGGAGCCGCGGCGGGTGG + Exonic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097705950 12:62868381-62868403 TCTGCCTGAGTCGCCGAGGCAGG - Intronic
1098355637 12:69610334-69610356 GCTCCTGGAGGCGCCGGAGCTGG + Exonic
1103209551 12:119156596-119156618 GCTCCGGGAGTAGCTGCGGCTGG - Exonic
1105240912 13:18609294-18609316 GAGGCTGGAGGCGCTGCGGCCGG + Intergenic
1105344412 13:19560321-19560343 GCGGCTGCAGTCCCTGCGGCTGG - Intergenic
1105459421 13:20569459-20569481 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1105535620 13:21261253-21261275 GCGGCTGCAGTCCCTGCGGCTGG + Intergenic
1107770920 13:43786914-43786936 GGCGCTGGAGACTCCGCGGCTGG + Intergenic
1108373411 13:49792521-49792543 GCCGCAGGAGTAGCCGCCGCCGG - Exonic
1115119847 14:29927095-29927117 GCGGCTGGCCCCGCCGCGGCTGG - Intronic
1116608610 14:47036156-47036178 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1119668149 14:76499214-76499236 GCCCCTGGAGTCGCTGTGGCTGG - Intronic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1121879515 14:97487538-97487560 GCTCCTGGAGAAGACGCGGCAGG - Intergenic
1122117130 14:99533368-99533390 GCTGCTGGAGTGGTCGCTGAAGG - Intronic
1123551721 15:21386183-21386205 GCGGCTGGAGTCCCCGCACCAGG + Intergenic
1124233584 15:27967674-27967696 CCTGCTTGAGTCCCTGCGGCTGG - Intronic
1124957228 15:34367327-34367349 GCGGCTGCGGGCGCCGCGGCGGG - Intergenic
1125671726 15:41478287-41478309 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1125721623 15:41847803-41847825 GCTGCTGGAGGCTCTGCGCCAGG + Exonic
1126786292 15:52179991-52180013 GCTGCTGGCGTCATCGCGGAGGG - Intronic
1127144097 15:56007250-56007272 GGTGCTGGTGCTGCCGCGGCTGG + Intergenic
1128003458 15:64216111-64216133 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1128322061 15:66701282-66701304 GCCCCTGGAGCCGGCGCGGCGGG - Intergenic
1129226845 15:74175080-74175102 CCTGCTGCAGTCGCTGTGGCTGG + Exonic
1129453340 15:75662934-75662956 GGTGCTGGAGTAGCCAAGGCTGG + Intergenic
1129524237 15:76203997-76204019 GCTGCTGGGATGGCAGCGGCGGG - Exonic
1129539222 15:76337704-76337726 GGGGCTGGAGTAGCCGAGGCCGG + Intronic
1130150619 15:81308781-81308803 GCTGCTGGAGACTCCTAGGCAGG + Exonic
1130913177 15:88284748-88284770 GCTGCTGCAGTCGGCGCGCCGGG - Intergenic
1131372854 15:91897737-91897759 GCTGCTGGAGCCCACGCTGCAGG - Intronic
1132368666 15:101277444-101277466 CCGGCTGGAGGCGCGGCGGCAGG - Exonic
1132447532 15:101939171-101939193 GCTGCTGGGGAGGCCGAGGCGGG - Intergenic
1132499920 16:280716-280738 GCTGCTGGAGCTGCTCCGGCTGG + Exonic
1132622391 16:874023-874045 GCTGGTGGAGGCCCGGCGGCGGG + Intronic
1133370074 16:5240174-5240196 GCTGCGGGAGGCTCCGTGGCCGG + Intergenic
1133779021 16:8922374-8922396 GCTACTTGAGACGCCGAGGCAGG + Intronic
1134073217 16:11273349-11273371 GCTGCTGGAGCCTGAGCGGCAGG - Exonic
1136229197 16:28877061-28877083 GCTGCTGGAGGAGCCGAGGGAGG - Intergenic
1136414741 16:30096224-30096246 GCTGCTGCCGCCGCTGCGGCGGG + Intronic
1137521721 16:49200706-49200728 GCTGCTGCAGTCGCCCAGGGAGG - Intergenic
1138370741 16:56524556-56524578 GCTGCTGGAGTCTCCTGTGCTGG - Intergenic
1138478274 16:57284658-57284680 GCTGCAGGAGGCGTCGGGGCTGG + Exonic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139528110 16:67528821-67528843 GCTGCCGCTGTCGCCGCCGCAGG - Intronic
1139778178 16:69330207-69330229 GCAGCTGGGGGTGCCGCGGCAGG - Exonic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1141430587 16:83968696-83968718 GCTCCGGGAGCCGCCGCAGCAGG + Exonic
1142019340 16:87771174-87771196 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1142622575 17:1174246-1174268 GCTGCTGGAGTCTCAGAGGTGGG - Intronic
1142699256 17:1649484-1649506 GCTGCAGGTGTCGGCGCAGCCGG - Exonic
1143548499 17:7614555-7614577 GCTGCTGCAGCCGCCGCCGGGGG - Exonic
1143885819 17:10064107-10064129 GCTGCAGCAGCCGCCGCTGCTGG - Intronic
1144185115 17:12789636-12789658 GCGGCAGGAGGCGGCGCGGCGGG + Exonic
1145306841 17:21680112-21680134 CCTGCTGCAGCCGCGGCGGCGGG + Intergenic
1146398418 17:32486472-32486494 GCAGCTGCGGGCGCCGCGGCGGG + Intergenic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147669626 17:42169536-42169558 GCTGCTTGAGCGGCCGCGGCAGG + Exonic
1147720514 17:42536760-42536782 GCTGCTGGAGGCGGCGCAGCTGG - Intronic
1147786307 17:42980840-42980862 GCGGCTGGACTCGGCGCTGCTGG + Exonic
1147787016 17:42986223-42986245 GCTACTTGAGTGGCCGAGGCGGG - Intronic
1147943504 17:44066607-44066629 GCTGCTGCCGCCGCCGCCGCCGG - Exonic
1149380608 17:56089809-56089831 GCTGCTGGAGATGACCCGGCTGG - Intergenic
1150690492 17:67362548-67362570 GCTACTGGGGACGCCGAGGCAGG + Intronic
1151939112 17:77281651-77281673 GCTGAGCGAGTCCCCGCGGCGGG + Intronic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152320777 17:79608055-79608077 GCCGCTGGAGGCGCTGCGGGCGG - Intergenic
1152426309 17:80220451-80220473 TCTCCTGGCGTCGCCGCAGCTGG - Exonic
1153457265 18:5295377-5295399 GCGGCTGTAGGCGGCGCGGCGGG + Intronic
1154448058 18:14450614-14450636 GAGGCTGGAGGCGCTGCGGCCGG - Intergenic
1156242993 18:35271710-35271732 GCAGCTGGAGCCTCCCCGGCGGG - Intronic
1157279093 18:46334164-46334186 GCTGCGGGAGCCGCCGGGGCGGG - Intronic
1157375271 18:47158368-47158390 CCTGCTGGAGTTGCCCAGGCTGG + Intronic
1157711624 18:49853625-49853647 GCTGCTGGAGGCTCAGCTGCAGG - Exonic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1160521008 18:79507928-79507950 GCAGCCGCAGTCGCCGCGTCAGG + Intronic
1160637740 19:93358-93380 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
1160698579 19:496019-496041 GCTACTGGAGTGGCTGAGGCAGG + Intronic
1160820324 19:1054813-1054835 GCTGCTCGAGGCGCTGCTGCAGG + Exonic
1160866174 19:1257136-1257158 GCTACTGCTGTCGCTGCGGCCGG - Exonic
1161001952 19:1915037-1915059 GCTGCTGGAGGCTCCCAGGCAGG - Intronic
1161008144 19:1946722-1946744 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1161101783 19:2425137-2425159 GCTGCTGGAGCTGGCGGGGCCGG + Exonic
1161252150 19:3285988-3286010 GCTGCAGGAGGGGCGGCGGCTGG - Exonic
1161264823 19:3359423-3359445 GCAGCCGGAGCCGCCGCAGCCGG + Intergenic
1161362109 19:3856197-3856219 CCTGCTGGCTTCCCCGCGGCAGG - Intronic
1161578762 19:5069170-5069192 GGTGCTGGGGTCGCCTTGGCTGG + Intronic
1161818171 19:6513024-6513046 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1162520109 19:11174650-11174672 GCTGCAGGAGTGGCTGCGCCTGG - Exonic
1163285036 19:16341334-16341356 GCTGCTGGGGAGGCCGAGGCAGG - Intergenic
1163343026 19:16721999-16722021 GCTACTTGAGACGCCGAGGCAGG + Intronic
1163392303 19:17038156-17038178 GCTGCTGGCGGAGCCGAGGCGGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1165465475 19:35972233-35972255 GCTGCTGCAGTAGTCCCGGCAGG + Intergenic
1165803231 19:38565565-38565587 GGCGCTGGAGACGCCGCGGAGGG + Exonic
1167109040 19:47448038-47448060 GCGGCTGGTGGCGCCGCTGCTGG - Exonic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167376355 19:49114413-49114435 GCTGGTGGAGCCGCTGGGGCTGG + Exonic
1167443737 19:49525348-49525370 GGTGCTGGAATCTCCGAGGCTGG + Intronic
1168293093 19:55366455-55366477 ACTGTTAGAGTCGCCGGGGCTGG + Intronic
927054852 2:19358462-19358484 GCGCTTGGAGTCCCCGCGGCAGG - Exonic
929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG + Exonic
931356031 2:61538220-61538242 GCGGCTGCAGCGGCCGCGGCAGG - Exonic
934105586 2:88691877-88691899 GCTGTTGGAGTCCCCGCAGCTGG - Exonic
937221289 2:120344512-120344534 GCGGCGGGAGTCGCCTCTGCTGG + Intergenic
937826684 2:126374281-126374303 GCTGCAGGCGTCGGGGCGGCAGG + Intergenic
942457779 2:176149783-176149805 GCTGCTGCAGACCCCGAGGCAGG - Intergenic
943302942 2:186226048-186226070 GCTACTGGAGAGGCCGAGGCAGG + Intergenic
946767331 2:223052865-223052887 GCTGCTGGAGGCGGCGGTGCCGG - Exonic
947815672 2:233034703-233034725 GCTGGTGGAGCCGCCGCCCCAGG + Exonic
948863237 2:240763018-240763040 CCTGCTGGAGCAGCAGCGGCTGG - Exonic
949040305 2:241844999-241845021 GCTGATGGAGGCTCCGGGGCGGG + Intergenic
1168762622 20:359885-359907 GCTGCTCGAGTAGCTGAGGCAGG + Intergenic
1170204636 20:13785059-13785081 GCAGCTGGAGATGCTGCGGCCGG + Exonic
1171382232 20:24742580-24742602 GCTGCTGCAGCCTCCGAGGCTGG + Intergenic
1171974878 20:31587984-31588006 GGCGCTGGACTCGCCGCGCCTGG - Intergenic
1174037756 20:47678683-47678705 GCTGCTGGACACGGAGCGGCCGG - Exonic
1174386499 20:50190913-50190935 GCTGCTGCTGCCGCCGCTGCCGG - Exonic
1174598962 20:51708621-51708643 GCTGCTTGAGTGGCCGAGGCAGG + Intronic
1175140144 20:56854998-56855020 GCTGCTCGAGAGGCCGAGGCAGG - Intergenic
1175785327 20:61708422-61708444 GATGCTGCAGTCGCCCTGGCTGG - Intronic
1175835130 20:61988955-61988977 CCTGCTGGGGTCGCGGCGCCAGG - Intronic
1175887972 20:62303049-62303071 GGTGCGGGAGTCGCCGGGCCTGG + Exonic
1176077820 20:63256477-63256499 GCGCCTGGGGTCCCCGCGGCTGG - Intronic
1176448172 21:6840079-6840101 GCGGCTCGAGGCGCTGCGGCCGG + Intergenic
1176826342 21:13705101-13705123 GCGGCTCGAGGCGCTGCGGCCGG + Intergenic
1176958999 21:15138716-15138738 GCTGCTGGAGACCCAGCTGCGGG + Intergenic
1178103951 21:29298686-29298708 GGGGCAGGGGTCGCCGCGGCCGG - Intronic
1179784860 21:43723816-43723838 GCCTCTGGAGCCGCCGAGGCTGG + Intronic
1180005969 21:45020811-45020833 GCTGCTGGCCTCGCCACGCCTGG - Intergenic
1180024555 21:45152496-45152518 GCTGCTGTTGTCGCAGCTGCCGG + Intronic
1180128613 21:45809633-45809655 GCTGCTGTAGTGGCAGCGGCAGG - Intronic
1180614877 22:17120621-17120643 GCAGCAGGAGGCGCCGCTGCCGG + Exonic
1181219492 22:21357975-21357997 GCTGCTGGAGTTGCTGCTGGCGG + Intergenic
1181317923 22:21982808-21982830 GCTTCTGGCGTCCCCGCGTCCGG + Intronic
1181725133 22:24806230-24806252 GCTGCTGCTGCAGCCGCGGCGGG - Intronic
1182664083 22:31944751-31944773 GCTGCTGCAGCGGGCGCGGCTGG + Exonic
1183093847 22:35540853-35540875 GCTGCTGGCGTCGCCGCGCGGGG + Exonic
1183199488 22:36376071-36376093 GCTACTGGAGTGGCTGAGGCAGG - Intronic
1183489091 22:38107331-38107353 TCTGCTGGTGTCCCCGCTGCGGG - Intronic
1183651812 22:39159871-39159893 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
950604265 3:14064484-14064506 GCTACTGGAGTTGCTGCTGCTGG - Exonic
950630102 3:14276625-14276647 GCAGCTGGAGTCCCTGCAGCTGG + Intergenic
953457765 3:43056227-43056249 GCTGCTGAAGTCGCTGCAGATGG + Exonic
954035721 3:47849943-47849965 GCTGCTGAAGGAGCTGCGGCGGG + Exonic
954618077 3:51980448-51980470 GCTGCTGGAGCGGGCGCTGCGGG + Exonic
955041775 3:55324422-55324444 GCTACTGGGGACGCCGAGGCAGG - Intergenic
955304159 3:57813205-57813227 GCTGCTCGAGACGCTGAGGCAGG - Intronic
959056655 3:101574189-101574211 GCTGCAGGGGAGGCCGCGGCGGG + Exonic
959380126 3:105631541-105631563 GCTGCTGGAGAAGCTGAGGCAGG + Intergenic
962722314 3:138187514-138187536 GCTGCTGCAGGCGCCGGCGCGGG - Exonic
965783863 3:172316117-172316139 GCTGCTCGAGTGGCCGAGGCAGG - Intronic
965911898 3:173788707-173788729 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
969114559 4:4863012-4863034 GCAGCTGTAGCGGCCGCGGCGGG + Exonic
969723139 4:8904362-8904384 GTTGCGGGGGTGGCCGCGGCTGG - Intergenic
971195705 4:24470765-24470787 GCTGCTGCTGCCGCGGCGGCGGG + Intergenic
976565991 4:86551714-86551736 GCTACTGGAGAGGCTGCGGCAGG - Intronic
978983841 4:114984206-114984228 GCTGATGGAGTCACCCAGGCTGG + Intronic
981913259 4:150007173-150007195 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
982073163 4:151713497-151713519 GCTGATGGAGTTGCAGCAGCTGG - Intronic
988470340 5:31531910-31531932 GGGGCTGGAGTCTCCGGGGCTGG - Intronic
988993913 5:36696330-36696352 TCTGCTGGAGTCGTCGGGGTTGG - Intergenic
989517755 5:42363314-42363336 GCTACTAGAGTCGCTGAGGCAGG - Intergenic
990330715 5:54722847-54722869 GCTGCTTGAGTGGCTGAGGCAGG - Intergenic
992910726 5:81393925-81393947 GCTGCGGGAGCGGCGGCGGCTGG - Intronic
1002497145 5:179623276-179623298 GGTGTTGGAGTCGCCGGGGTGGG - Exonic
1003212243 6:4078815-4078837 GCTGCGGGATTCCCCGGGGCCGG + Intronic
1006614682 6:35318354-35318376 GCTGCAGGAGGCGCAGCGGCAGG + Exonic
1008365663 6:50676829-50676851 GAGGCTGGAGTCACCGAGGCTGG + Intergenic
1013366229 6:109440515-109440537 GCTGCCGGAGCGGCCGCTGCAGG - Exonic
1013422534 6:109979227-109979249 GCTCCTAGAGCCGCCGCAGCAGG - Exonic
1015076099 6:129159441-129159463 GGTGATGGAGGCGCCCCGGCCGG + Intronic
1015979583 6:138825469-138825491 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1017164149 6:151391525-151391547 GCTGCTGCTGCCGCCGCGGTCGG + Exonic
1017944323 6:159081187-159081209 GCTGCTGGGGTGGCTGAGGCAGG + Intergenic
1018911279 6:168101863-168101885 GCTGCTGGCGACCCCGCTGCCGG + Intergenic
1019253770 7:35468-35490 GCTGCTGCCGCCGCCGCCGCCGG + Intergenic
1019390805 7:785914-785936 GCTGCTGAAGTGGCTGCGGGAGG - Exonic
1019420286 7:947697-947719 GCTGCTGCAGTGACCGAGGCCGG - Intronic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1023254827 7:38302465-38302487 GCTGCTGGAGTTGCAGGGTCTGG - Intergenic
1023425936 7:40036050-40036072 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1026615496 7:71899253-71899275 GCTGCTGGGGAGGCTGCGGCAGG - Intronic
1026787913 7:73313344-73313366 GCCGCAGGAGAAGCCGCGGCTGG + Exonic
1026941386 7:74289741-74289763 GCTGCTGGAGGGGCCGAGGGAGG + Intronic
1027656518 7:80936895-80936917 GCTGCTCGAGAGGCTGCGGCAGG - Intergenic
1029537051 7:101163172-101163194 GCGGCTGCAGTGTCCGCGGCCGG + Exonic
1029713725 7:102314386-102314408 GCTGCAGGAGGCCACGCGGCTGG - Exonic
1030047368 7:105509595-105509617 GCTGCTGTAGTCCCAGCTGCTGG - Intronic
1033119356 7:138653226-138653248 GCTGCTGGAGAAGCTGCAGCAGG + Intronic
1034342766 7:150368837-150368859 CCTGCCGCTGTCGCCGCGGCGGG + Exonic
1035168042 7:157003209-157003231 CCTGCTGGAGGCGCAGGGGCCGG + Intronic
1035234774 7:157489171-157489193 CCTGCTGGAGTCGCTGGGGGAGG - Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1038017769 8:23529459-23529481 GCTGCTGGCGGCGCTGAGGCGGG + Intronic
1039273255 8:35906564-35906586 GCTGCAGGAGTGGGGGCGGCAGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039550347 8:38438958-38438980 CCTGCTGGACTCGCAGGGGCAGG - Intronic
1039913315 8:41841902-41841924 GCTGGGGGAGTCCCCACGGCAGG - Intronic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1041107853 8:54459161-54459183 CCTGCTTGCGCCGCCGCGGCCGG - Exonic
1044613760 8:94119503-94119525 CCTGCTGGAGCGGCCGCTGCAGG + Intergenic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1049052738 8:140211445-140211467 GCTACTTGAGTCGCTGAGGCAGG + Intronic
1049336488 8:142089405-142089427 GCTGCTGCAGTCTCCACTGCTGG - Intergenic
1049587519 8:143438903-143438925 GCTGCTGGAGCGGCCACCGCAGG - Intronic
1052335564 9:27316235-27316257 GCTACTGGAGACGCTGAGGCAGG + Intergenic
1055093931 9:72390698-72390720 GCTACTGGAGTGGCTGAGGCAGG + Intergenic
1055699417 9:78926577-78926599 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1056475256 9:86946671-86946693 GCTGCTGGGCTCGGCGCCGCGGG - Exonic
1057314604 9:93960387-93960409 TCTGCGGGAGCCGCCGGGGCTGG - Intergenic
1058976768 9:110132161-110132183 GCTGCTTGAGAGGCCGAGGCAGG - Intronic
1060531136 9:124347580-124347602 CCTGCTGGACTCGCCGCGGTCGG + Intronic
1061289161 9:129641114-129641136 GCTGCAGGTGTTGCCGGGGCTGG - Intronic
1062746626 9:138217075-138217097 GCTGCTGCTGCCGCCGCTGCCGG - Intergenic
1203778538 EBV:87855-87877 GCGGCAGGAGGCCCCGCGGCAGG - Intergenic
1203778544 EBV:87870-87892 GCGGCAGGAGGCCCCGCGGCAGG - Intergenic
1203778550 EBV:87885-87907 GCGGCAGGAGGCCCCGCGGCAGG - Intergenic
1203778556 EBV:87900-87922 GCGGCAGGAGGCCCCGCGGCAGG - Intergenic
1203778562 EBV:87915-87937 GCGGCAGGAGGCCCCGCGGCAGG - Intergenic
1203521019 Un_GL000213v1:44439-44461 GCGGCTCGAGGCGCTGCGGCCGG - Intergenic
1186186092 X:7021010-7021032 TCTGCTGGAATCGCCAGGGCAGG + Intergenic
1187064822 X:15823133-15823155 GCCGCAGGAGCCGCCGCAGCCGG + Exonic
1188004116 X:25005623-25005645 ACAGCTGGGGTCGCCGCGCCAGG - Intronic
1189160294 X:38803787-38803809 GAATCTGGAGTGGCCGCGGCCGG - Exonic
1190747490 X:53333256-53333278 GCTACTCGAGTGGCCGGGGCAGG - Intergenic
1197746125 X:129932857-129932879 GCTGCGGGAGGAACCGCGGCCGG - Intergenic
1199419102 X:147622491-147622513 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1200011029 X:153121019-153121041 GCTGCTAGAGGCGCCAGGGCTGG - Intergenic
1200028570 X:153278903-153278925 GCTGCTAGAGGCGCCAGGGCTGG + Intergenic
1200089794 X:153629187-153629209 GCTCCTGGAGTCCCTGAGGCAGG - Intergenic
1200100650 X:153687984-153688006 GCGGCTGCAGCCGCCGCCGCCGG + Intronic
1200119534 X:153783817-153783839 GCTGCTGGAGGAGCGGCTGCGGG + Exonic