ID: 1036470847

View in Genome Browser
Species Human (GRCh38)
Location 8:9051274-9051296
Sequence GACTCTGTGGAGTCCTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036470844_1036470847 -7 Left 1036470844 8:9051258-9051280 CCTTGTTGCTGGTGGGGACTCTG 0: 2
1: 66
2: 162
3: 309
4: 593
Right 1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG No data
1036470836_1036470847 23 Left 1036470836 8:9051228-9051250 CCACGGTTGAGGGACTGCATCTG 0: 1
1: 5
2: 43
3: 109
4: 282
Right 1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036470847 Original CRISPR GACTCTGTGGAGTCCTGAGG TGG Intronic
No off target data available for this crispr