ID: 1036474390

View in Genome Browser
Species Human (GRCh38)
Location 8:9079958-9079980
Sequence ACTATGCTTGGCCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036474387_1036474390 6 Left 1036474387 8:9079929-9079951 CCAAAGTGCTGTGATTACAGGTG No data
Right 1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG No data
1036474381_1036474390 23 Left 1036474381 8:9079912-9079934 CCTCCAGCCTTGGCCTCCCAAAG No data
Right 1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG No data
1036474386_1036474390 7 Left 1036474386 8:9079928-9079950 CCCAAAGTGCTGTGATTACAGGT No data
Right 1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG No data
1036474382_1036474390 20 Left 1036474382 8:9079915-9079937 CCAGCCTTGGCCTCCCAAAGTGC No data
Right 1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG No data
1036474384_1036474390 10 Left 1036474384 8:9079925-9079947 CCTCCCAAAGTGCTGTGATTACA No data
Right 1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG No data
1036474383_1036474390 16 Left 1036474383 8:9079919-9079941 CCTTGGCCTCCCAAAGTGCTGTG No data
Right 1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036474390 Original CRISPR ACTATGCTTGGCCCACAAGC AGG Intronic