ID: 1036476179

View in Genome Browser
Species Human (GRCh38)
Location 8:9095608-9095630
Sequence GAGGATCACCTGAAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63747
Summary {0: 1, 1: 8, 2: 321, 3: 6037, 4: 57380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036476179_1036476185 2 Left 1036476179 8:9095608-9095630 CCTCCCTGCTTCAGGTGATCCTC 0: 1
1: 8
2: 321
3: 6037
4: 57380
Right 1036476185 8:9095633-9095655 ACCTTAGACTCCTGAGTAGCTGG No data
1036476179_1036476188 11 Left 1036476179 8:9095608-9095630 CCTCCCTGCTTCAGGTGATCCTC 0: 1
1: 8
2: 321
3: 6037
4: 57380
Right 1036476188 8:9095642-9095664 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
1036476179_1036476187 3 Left 1036476179 8:9095608-9095630 CCTCCCTGCTTCAGGTGATCCTC 0: 1
1: 8
2: 321
3: 6037
4: 57380
Right 1036476187 8:9095634-9095656 CCTTAGACTCCTGAGTAGCTGGG 0: 41
1: 5221
2: 113134
3: 216803
4: 243235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036476179 Original CRISPR GAGGATCACCTGAAGCAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr