ID: 1036477659

View in Genome Browser
Species Human (GRCh38)
Location 8:9108195-9108217
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036477654_1036477659 18 Left 1036477654 8:9108154-9108176 CCTTGGTACTGACGGGTAGATTT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1036477659 8:9108195-9108217 CCAAGGAGGCAGCTCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr