ID: 1036479296

View in Genome Browser
Species Human (GRCh38)
Location 8:9124034-9124056
Sequence TGGCCTGGCAAGAGTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036479296_1036479304 18 Left 1036479296 8:9124034-9124056 CCAATACCACTCTTGCCAGGCCA No data
Right 1036479304 8:9124075-9124097 GTGCCTGCTCAGTGACTCTTGGG No data
1036479296_1036479303 17 Left 1036479296 8:9124034-9124056 CCAATACCACTCTTGCCAGGCCA No data
Right 1036479303 8:9124074-9124096 TGTGCCTGCTCAGTGACTCTTGG No data
1036479296_1036479306 28 Left 1036479296 8:9124034-9124056 CCAATACCACTCTTGCCAGGCCA No data
Right 1036479306 8:9124085-9124107 AGTGACTCTTGGGCTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036479296 Original CRISPR TGGCCTGGCAAGAGTGGTAT TGG (reversed) Intergenic
No off target data available for this crispr