ID: 1036479367

View in Genome Browser
Species Human (GRCh38)
Location 8:9124640-9124662
Sequence TCTCTTAGAGGGGGCTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036479367_1036479374 2 Left 1036479367 8:9124640-9124662 CCACTGGAGCCCCCTCTAAGAGA No data
Right 1036479374 8:9124665-9124687 CAAACAGGTGCTCACCCACAGGG No data
1036479367_1036479375 3 Left 1036479367 8:9124640-9124662 CCACTGGAGCCCCCTCTAAGAGA No data
Right 1036479375 8:9124666-9124688 AAACAGGTGCTCACCCACAGGGG No data
1036479367_1036479373 1 Left 1036479367 8:9124640-9124662 CCACTGGAGCCCCCTCTAAGAGA No data
Right 1036479373 8:9124664-9124686 ACAAACAGGTGCTCACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036479367 Original CRISPR TCTCTTAGAGGGGGCTCCAG TGG (reversed) Intergenic