ID: 1036487991

View in Genome Browser
Species Human (GRCh38)
Location 8:9196924-9196946
Sequence TTTTATCTTTAGAACTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036487987_1036487991 1 Left 1036487987 8:9196900-9196922 CCGAGTGTTAGGCCCTGGGCCAA No data
Right 1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG No data
1036487984_1036487991 9 Left 1036487984 8:9196892-9196914 CCTGTCTACCGAGTGTTAGGCCC No data
Right 1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036487991 Original CRISPR TTTTATCTTTAGAACTTTGA AGG Intergenic
No off target data available for this crispr