ID: 1036488527

View in Genome Browser
Species Human (GRCh38)
Location 8:9201962-9201984
Sequence CTGAATGAAGAGCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036488527_1036488529 -9 Left 1036488527 8:9201962-9201984 CCTTGCTCCAGCTCTTCATTCAG No data
Right 1036488529 8:9201976-9201998 TTCATTCAGCCTTTTCTTCAAGG No data
1036488527_1036488534 19 Left 1036488527 8:9201962-9201984 CCTTGCTCCAGCTCTTCATTCAG No data
Right 1036488534 8:9202004-9202026 TGTGTCTTTTTTTTGGAGAATGG No data
1036488527_1036488531 12 Left 1036488527 8:9201962-9201984 CCTTGCTCCAGCTCTTCATTCAG No data
Right 1036488531 8:9201997-9202019 GGAGCCCTGTGTCTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036488527 Original CRISPR CTGAATGAAGAGCTGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr