ID: 1036489566

View in Genome Browser
Species Human (GRCh38)
Location 8:9212360-9212382
Sequence ATGGAGGCCCAGAGATATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036489566_1036489570 -3 Left 1036489566 8:9212360-9212382 CCTTAATATCTCTGGGCCTCCAT No data
Right 1036489570 8:9212380-9212402 CATGTTCTCACCTGTGAAACGGG No data
1036489566_1036489569 -4 Left 1036489566 8:9212360-9212382 CCTTAATATCTCTGGGCCTCCAT No data
Right 1036489569 8:9212379-9212401 CCATGTTCTCACCTGTGAAACGG No data
1036489566_1036489571 -2 Left 1036489566 8:9212360-9212382 CCTTAATATCTCTGGGCCTCCAT No data
Right 1036489571 8:9212381-9212403 ATGTTCTCACCTGTGAAACGGGG No data
1036489566_1036489573 12 Left 1036489566 8:9212360-9212382 CCTTAATATCTCTGGGCCTCCAT No data
Right 1036489573 8:9212395-9212417 GAAACGGGGAGAATTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036489566 Original CRISPR ATGGAGGCCCAGAGATATTA AGG (reversed) Intergenic
No off target data available for this crispr