ID: 1036494970

View in Genome Browser
Species Human (GRCh38)
Location 8:9262030-9262052
Sequence TCCTCTCCCTCCACATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036494968_1036494970 8 Left 1036494968 8:9261999-9262021 CCATACCTAGGTAAGGTCAATTC No data
Right 1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG No data
1036494963_1036494970 28 Left 1036494963 8:9261979-9262001 CCCCTTGGATTCAACAAGAGCCA No data
Right 1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG No data
1036494964_1036494970 27 Left 1036494964 8:9261980-9262002 CCCTTGGATTCAACAAGAGCCAT No data
Right 1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG No data
1036494969_1036494970 3 Left 1036494969 8:9262004-9262026 CCTAGGTAAGGTCAATTCAGAGA No data
Right 1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG No data
1036494965_1036494970 26 Left 1036494965 8:9261981-9262003 CCTTGGATTCAACAAGAGCCATA No data
Right 1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036494970 Original CRISPR TCCTCTCCCTCCACATGAGA AGG Intergenic
No off target data available for this crispr