ID: 1036495560

View in Genome Browser
Species Human (GRCh38)
Location 8:9267195-9267217
Sequence AATGGAGGTAACTACCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036495560_1036495569 21 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495569 8:9267239-9267261 CTTGGAAGGGGACTGTTTGATGG No data
1036495560_1036495564 3 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495564 8:9267221-9267243 TGTGCTCCTTAAGCTGTACTTGG No data
1036495560_1036495568 9 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495568 8:9267227-9267249 CCTTAAGCTGTACTTGGAAGGGG No data
1036495560_1036495565 7 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495565 8:9267225-9267247 CTCCTTAAGCTGTACTTGGAAGG No data
1036495560_1036495570 26 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG No data
1036495560_1036495566 8 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495566 8:9267226-9267248 TCCTTAAGCTGTACTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036495560 Original CRISPR AATGGAGGTAACTACCACAA TGG (reversed) Intergenic
No off target data available for this crispr