ID: 1036495565

View in Genome Browser
Species Human (GRCh38)
Location 8:9267225-9267247
Sequence CTCCTTAAGCTGTACTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036495561_1036495565 -8 Left 1036495561 8:9267210-9267232 CCTCCATTTCCTGTGCTCCTTAA No data
Right 1036495565 8:9267225-9267247 CTCCTTAAGCTGTACTTGGAAGG No data
1036495560_1036495565 7 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495565 8:9267225-9267247 CTCCTTAAGCTGTACTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036495565 Original CRISPR CTCCTTAAGCTGTACTTGGA AGG Intergenic
No off target data available for this crispr