ID: 1036495570

View in Genome Browser
Species Human (GRCh38)
Location 8:9267244-9267266
Sequence AAGGGGACTGTTTGATGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036495563_1036495570 2 Left 1036495563 8:9267219-9267241 CCTGTGCTCCTTAAGCTGTACTT No data
Right 1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG No data
1036495567_1036495570 -6 Left 1036495567 8:9267227-9267249 CCTTAAGCTGTACTTGGAAGGGG No data
Right 1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG No data
1036495562_1036495570 8 Left 1036495562 8:9267213-9267235 CCATTTCCTGTGCTCCTTAAGCT No data
Right 1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG No data
1036495561_1036495570 11 Left 1036495561 8:9267210-9267232 CCTCCATTTCCTGTGCTCCTTAA No data
Right 1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG No data
1036495560_1036495570 26 Left 1036495560 8:9267195-9267217 CCATTGTGGTAGTTACCTCCATT No data
Right 1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036495570 Original CRISPR AAGGGGACTGTTTGATGGTA AGG Intergenic
No off target data available for this crispr