ID: 1036497235

View in Genome Browser
Species Human (GRCh38)
Location 8:9280355-9280377
Sequence CTGGGGGAGCAGAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036497226_1036497235 5 Left 1036497226 8:9280327-9280349 CCTTTCTTCTTTCCATCCTTCTA No data
Right 1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG No data
1036497224_1036497235 22 Left 1036497224 8:9280310-9280332 CCCTTTCTTGTGTCTTTCCTTTC No data
Right 1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG No data
1036497230_1036497235 -7 Left 1036497230 8:9280339-9280361 CCATCCTTCTACAGTTCTGGGGG No data
Right 1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG No data
1036497225_1036497235 21 Left 1036497225 8:9280311-9280333 CCTTTCTTGTGTCTTTCCTTTCT No data
Right 1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036497235 Original CRISPR CTGGGGGAGCAGAATGAGGG AGG Intergenic
No off target data available for this crispr