ID: 1036498515

View in Genome Browser
Species Human (GRCh38)
Location 8:9292750-9292772
Sequence TCTACCTCCCTTCAAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036498515_1036498520 22 Left 1036498515 8:9292750-9292772 CCAGGATCTTGAAGGGAGGTAGA No data
Right 1036498520 8:9292795-9292817 TGCAACCCCTGTACATGAAGAGG No data
1036498515_1036498522 24 Left 1036498515 8:9292750-9292772 CCAGGATCTTGAAGGGAGGTAGA No data
Right 1036498522 8:9292797-9292819 CAACCCCTGTACATGAAGAGGGG No data
1036498515_1036498521 23 Left 1036498515 8:9292750-9292772 CCAGGATCTTGAAGGGAGGTAGA No data
Right 1036498521 8:9292796-9292818 GCAACCCCTGTACATGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036498515 Original CRISPR TCTACCTCCCTTCAAGATCC TGG (reversed) Intergenic
No off target data available for this crispr