ID: 1036498520

View in Genome Browser
Species Human (GRCh38)
Location 8:9292795-9292817
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036498515_1036498520 22 Left 1036498515 8:9292750-9292772 CCAGGATCTTGAAGGGAGGTAGA No data
Right 1036498520 8:9292795-9292817 TGCAACCCCTGTACATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036498520 Original CRISPR TGCAACCCCTGTACATGAAG AGG Intergenic
No off target data available for this crispr