ID: 1036505172

View in Genome Browser
Species Human (GRCh38)
Location 8:9348280-9348302
Sequence TGACCCCTGGATAAAACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036505172_1036505174 -1 Left 1036505172 8:9348280-9348302 CCACTTGTTTTATCCAGGGGTCA No data
Right 1036505174 8:9348302-9348324 AACTCTCTGCTCCATCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036505172 Original CRISPR TGACCCCTGGATAAAACAAG TGG (reversed) Intergenic
No off target data available for this crispr