ID: 1036508267

View in Genome Browser
Species Human (GRCh38)
Location 8:9376400-9376422
Sequence TGATCTAGATCAAGGGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036508267_1036508275 24 Left 1036508267 8:9376400-9376422 CCAACAGCCCTTGATCTAGATCA No data
Right 1036508275 8:9376447-9376469 GCGCTGATCCATTGGAGTGCTGG No data
1036508267_1036508273 16 Left 1036508267 8:9376400-9376422 CCAACAGCCCTTGATCTAGATCA No data
Right 1036508273 8:9376439-9376461 AATGTCCAGCGCTGATCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036508267 Original CRISPR TGATCTAGATCAAGGGCTGT TGG (reversed) Intergenic