ID: 1036508267 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:9376400-9376422 |
| Sequence | TGATCTAGATCAAGGGCTGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036508267_1036508275 | 24 | Left | 1036508267 | 8:9376400-9376422 | CCAACAGCCCTTGATCTAGATCA | No data | ||
| Right | 1036508275 | 8:9376447-9376469 | GCGCTGATCCATTGGAGTGCTGG | No data | ||||
| 1036508267_1036508273 | 16 | Left | 1036508267 | 8:9376400-9376422 | CCAACAGCCCTTGATCTAGATCA | No data | ||
| Right | 1036508273 | 8:9376439-9376461 | AATGTCCAGCGCTGATCCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036508267 | Original CRISPR | TGATCTAGATCAAGGGCTGT TGG (reversed) | Intergenic | ||