ID: 1036509150

View in Genome Browser
Species Human (GRCh38)
Location 8:9384394-9384416
Sequence ACGAATTCAGAATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036509145_1036509150 -3 Left 1036509145 8:9384374-9384396 CCTAGGCTTTCTCCCAACCAACG No data
Right 1036509150 8:9384394-9384416 ACGAATTCAGAATTTCTTGGAGG No data
1036509143_1036509150 28 Left 1036509143 8:9384343-9384365 CCAATAATTTGTACTGGTTAAAA No data
Right 1036509150 8:9384394-9384416 ACGAATTCAGAATTTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036509150 Original CRISPR ACGAATTCAGAATTTCTTGG AGG Intergenic
No off target data available for this crispr