ID: 1036511311

View in Genome Browser
Species Human (GRCh38)
Location 8:9402917-9402939
Sequence CCTTCCCTTAATTTTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036511311_1036511315 24 Left 1036511311 8:9402917-9402939 CCTCTTTTAAAATTAAGGGAAGG No data
Right 1036511315 8:9402964-9402986 TCAGGCTGTGTGGCACTTCGTGG No data
1036511311_1036511313 6 Left 1036511311 8:9402917-9402939 CCTCTTTTAAAATTAAGGGAAGG No data
Right 1036511313 8:9402946-9402968 AATATTTATTCTCTGTAGTCAGG No data
1036511311_1036511314 14 Left 1036511311 8:9402917-9402939 CCTCTTTTAAAATTAAGGGAAGG No data
Right 1036511314 8:9402954-9402976 TTCTCTGTAGTCAGGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036511311 Original CRISPR CCTTCCCTTAATTTTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr