ID: 1036514338

View in Genome Browser
Species Human (GRCh38)
Location 8:9429910-9429932
Sequence CTGAGTAGACAGAATTACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036514330_1036514338 13 Left 1036514330 8:9429874-9429896 CCTCCCAGGTTCAAGCAATTCTT 0: 2094
1: 26739
2: 73590
3: 142895
4: 182286
Right 1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG No data
1036514331_1036514338 10 Left 1036514331 8:9429877-9429899 CCCAGGTTCAAGCAATTCTTCTG 0: 1452
1: 25103
2: 88853
3: 165623
4: 214492
Right 1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG No data
1036514332_1036514338 9 Left 1036514332 8:9429878-9429900 CCAGGTTCAAGCAATTCTTCTGC 0: 2432
1: 38055
2: 89969
3: 155876
4: 99146
Right 1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036514338 Original CRISPR CTGAGTAGACAGAATTACAG GGG Intergenic
No off target data available for this crispr