ID: 1036514750 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:9433506-9433528 |
Sequence | GTCCCTCTATTTCCCCGGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1036514750_1036514757 | 19 | Left | 1036514750 | 8:9433506-9433528 | CCAGCCCGGGGAAATAGAGGGAC | No data | ||
Right | 1036514757 | 8:9433548-9433570 | TAAGAATTATCCAGATATGGCGG | No data | ||||
1036514750_1036514756 | 16 | Left | 1036514750 | 8:9433506-9433528 | CCAGCCCGGGGAAATAGAGGGAC | No data | ||
Right | 1036514756 | 8:9433545-9433567 | ATGTAAGAATTATCCAGATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1036514750 | Original CRISPR | GTCCCTCTATTTCCCCGGGC TGG (reversed) | Intergenic | ||