ID: 1036514750

View in Genome Browser
Species Human (GRCh38)
Location 8:9433506-9433528
Sequence GTCCCTCTATTTCCCCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036514750_1036514757 19 Left 1036514750 8:9433506-9433528 CCAGCCCGGGGAAATAGAGGGAC No data
Right 1036514757 8:9433548-9433570 TAAGAATTATCCAGATATGGCGG No data
1036514750_1036514756 16 Left 1036514750 8:9433506-9433528 CCAGCCCGGGGAAATAGAGGGAC No data
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036514750 Original CRISPR GTCCCTCTATTTCCCCGGGC TGG (reversed) Intergenic
No off target data available for this crispr