ID: 1036514756

View in Genome Browser
Species Human (GRCh38)
Location 8:9433545-9433567
Sequence ATGTAAGAATTATCCAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036514751_1036514756 12 Left 1036514751 8:9433510-9433532 CCCGGGGAAATAGAGGGACCCCA No data
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data
1036514752_1036514756 11 Left 1036514752 8:9433511-9433533 CCGGGGAAATAGAGGGACCCCAT No data
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data
1036514755_1036514756 -8 Left 1036514755 8:9433530-9433552 CCATCTCTACAAAAAATGTAAGA 0: 4
1: 136
2: 2687
3: 29539
4: 245974
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data
1036514754_1036514756 -7 Left 1036514754 8:9433529-9433551 CCCATCTCTACAAAAAATGTAAG 0: 4
1: 112
2: 2156
3: 21145
4: 143658
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data
1036514744_1036514756 30 Left 1036514744 8:9433492-9433514 CCAGGAGTTCGAGACCAGCCCGG 0: 128
1: 10742
2: 54863
3: 69163
4: 50631
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data
1036514750_1036514756 16 Left 1036514750 8:9433506-9433528 CCAGCCCGGGGAAATAGAGGGAC No data
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data
1036514753_1036514756 -6 Left 1036514753 8:9433528-9433550 CCCCATCTCTACAAAAAATGTAA 0: 67
1: 1683
2: 17281
3: 123079
4: 216207
Right 1036514756 8:9433545-9433567 ATGTAAGAATTATCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036514756 Original CRISPR ATGTAAGAATTATCCAGATA TGG Intergenic
No off target data available for this crispr