ID: 1036521654

View in Genome Browser
Species Human (GRCh38)
Location 8:9497265-9497287
Sequence GAGAAGTATTTCCAGTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036521651_1036521654 -2 Left 1036521651 8:9497244-9497266 CCATTAATAATGATTGTTTCTGA No data
Right 1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG No data
1036521650_1036521654 18 Left 1036521650 8:9497224-9497246 CCAGAATGCTATATAAGAAGCCA No data
Right 1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036521654 Original CRISPR GAGAAGTATTTCCAGTGGGT TGG Intergenic
No off target data available for this crispr