ID: 1036522561

View in Genome Browser
Species Human (GRCh38)
Location 8:9505496-9505518
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036522561_1036522565 14 Left 1036522561 8:9505496-9505518 CCTAAAATTACTGGCCTCTCCCT No data
Right 1036522565 8:9505533-9505555 GAAGCCTTGCTGTTGTCAACTGG No data
1036522561_1036522566 15 Left 1036522561 8:9505496-9505518 CCTAAAATTACTGGCCTCTCCCT No data
Right 1036522566 8:9505534-9505556 AAGCCTTGCTGTTGTCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036522561 Original CRISPR AGGGAGAGGCCAGTAATTTT AGG (reversed) Intergenic
No off target data available for this crispr