ID: 1036527350

View in Genome Browser
Species Human (GRCh38)
Location 8:9547549-9547571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036527346_1036527350 10 Left 1036527346 8:9547516-9547538 CCTAATAGCAAGCAAATTTCTCG No data
Right 1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036527350 Original CRISPR AGTTATCCACAGAGGATGGC AGG Intergenic
No off target data available for this crispr