ID: 1036527401

View in Genome Browser
Species Human (GRCh38)
Location 8:9547951-9547973
Sequence GACCCCTAGAAACTTCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036527394_1036527401 20 Left 1036527394 8:9547908-9547930 CCTTCATGTTACAAGAGATATCT No data
Right 1036527401 8:9547951-9547973 GACCCCTAGAAACTTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036527401 Original CRISPR GACCCCTAGAAACTTCACTG GGG Intergenic
No off target data available for this crispr