ID: 1036529501

View in Genome Browser
Species Human (GRCh38)
Location 8:9570487-9570509
Sequence ATGGCCCAGTGGCATTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036529491_1036529501 16 Left 1036529491 8:9570448-9570470 CCACCAGTCCCTTGCTGGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1036529501 8:9570487-9570509 ATGGCCCAGTGGCATTAGGATGG No data
1036529493_1036529501 13 Left 1036529493 8:9570451-9570473 CCAGTCCCTTGCTGGCGTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 1036529501 8:9570487-9570509 ATGGCCCAGTGGCATTAGGATGG No data
1036529496_1036529501 7 Left 1036529496 8:9570457-9570479 CCTTGCTGGCGTGGTGGACAGAA 0: 1
1: 0
2: 2
3: 9
4: 114
Right 1036529501 8:9570487-9570509 ATGGCCCAGTGGCATTAGGATGG No data
1036529495_1036529501 8 Left 1036529495 8:9570456-9570478 CCCTTGCTGGCGTGGTGGACAGA 0: 1
1: 0
2: 1
3: 3
4: 114
Right 1036529501 8:9570487-9570509 ATGGCCCAGTGGCATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036529501 Original CRISPR ATGGCCCAGTGGCATTAGGA TGG Intronic
No off target data available for this crispr