ID: 1036531166

View in Genome Browser
Species Human (GRCh38)
Location 8:9588827-9588849
Sequence CTATGGTTCTTTTAGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036531163_1036531166 0 Left 1036531163 8:9588804-9588826 CCATCTCTAATGAGCTGCTTGGC 0: 1
1: 0
2: 0
3: 20
4: 256
Right 1036531166 8:9588827-9588849 CTATGGTTCTTTTAGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036531166 Original CRISPR CTATGGTTCTTTTAGTGACC AGG Intronic
No off target data available for this crispr