ID: 1036538642

View in Genome Browser
Species Human (GRCh38)
Location 8:9679343-9679365
Sequence TCCAAGAGGTTCATGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036538635_1036538642 21 Left 1036538635 8:9679299-9679321 CCATTTAAGAATGTATTCACTGT 0: 1
1: 0
2: 0
3: 29
4: 318
Right 1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036538642 Original CRISPR TCCAAGAGGTTCATGGCATT TGG Intronic
No off target data available for this crispr