ID: 1036541461

View in Genome Browser
Species Human (GRCh38)
Location 8:9716663-9716685
Sequence AAGAGGGGAAAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2544
Summary {0: 1, 1: 0, 2: 25, 3: 287, 4: 2231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036541461_1036541470 27 Left 1036541461 8:9716663-9716685 CCTGCTTCCCTCTTTCCCCTCTT 0: 1
1: 0
2: 25
3: 287
4: 2231
Right 1036541470 8:9716713-9716735 TCTCTCTTTCTCTTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036541461 Original CRISPR AAGAGGGGAAAGAGGGAAGC AGG (reversed) Intronic
Too many off-targets to display for this crispr