ID: 1036541716

View in Genome Browser
Species Human (GRCh38)
Location 8:9720473-9720495
Sequence CCTTGTAAGGAGATGATGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036541716_1036541722 -2 Left 1036541716 8:9720473-9720495 CCCTCCATCATCTCCTTACAAGG 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036541722 8:9720494-9720516 GGCTTCACAGCAGCACAGATGGG 0: 1
1: 0
2: 1
3: 18
4: 238
1036541716_1036541723 28 Left 1036541716 8:9720473-9720495 CCCTCCATCATCTCCTTACAAGG 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036541723 8:9720524-9720546 GCAGTGCAGCAGATTCTGAGTGG 0: 1
1: 0
2: 3
3: 16
4: 220
1036541716_1036541721 -3 Left 1036541716 8:9720473-9720495 CCCTCCATCATCTCCTTACAAGG 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036541721 8:9720493-9720515 AGGCTTCACAGCAGCACAGATGG 0: 1
1: 0
2: 3
3: 49
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036541716 Original CRISPR CCTTGTAAGGAGATGATGGA GGG (reversed) Exonic
902145661 1:14396691-14396713 ACTTGTAACGAAGTGATGGAGGG - Intergenic
903767657 1:25744996-25745018 AGTTGTAAGGAGTTGATGGGAGG + Intronic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
907661950 1:56401402-56401424 CCCAGGAAGGAGATGCTGGAGGG - Intergenic
908056908 1:60297690-60297712 TCTTCTATTGAGATGATGGAGGG + Intergenic
913491554 1:119384622-119384644 CCTTGTAAGAAAGGGATGGAAGG - Intronic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
920056808 1:203198757-203198779 CCTTATGAGCGGATGATGGAGGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920729546 1:208470129-208470151 ACTAGGAATGAGATGATGGAAGG - Intergenic
922370615 1:224907101-224907123 CCTAGGTAGGAGATAATGGATGG + Intronic
1063040923 10:2336478-2336500 GGTGGTAAGCAGATGATGGATGG + Intergenic
1064696950 10:17976202-17976224 CCTTGTGGGGAGATGATTGGTGG + Intronic
1065537843 10:26731980-26732002 GCTTGTAAGGATGTGATGCAAGG + Intronic
1068145767 10:53068335-53068357 CCTTGTAAAGAAAGGATGAAGGG - Intergenic
1070400503 10:76049216-76049238 CCTTGGAAGGAGTTGAGGGGTGG + Intronic
1071959153 10:90792546-90792568 AGTTGTAAAGAGATTATGGATGG + Intronic
1072093399 10:92151915-92151937 CCTTGTTAGGAGGTGATGTCAGG - Intronic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1086641540 11:89163865-89163887 CGTTGCTAGGAGATGAGGGAAGG + Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087461043 11:98447834-98447856 CCTGGTAAGGAAATGATGGTTGG + Intergenic
1087798191 11:102476506-102476528 GCATGTAAGGAGATGGTGAAAGG + Intronic
1088696462 11:112370355-112370377 CCTTGGAAGGGCTTGATGGAGGG + Intergenic
1088961380 11:114669319-114669341 GCTTGGAAAGAGAAGATGGAAGG - Intergenic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1090558390 11:127901463-127901485 CCTTGAAAGGAGATGAAATAAGG - Intergenic
1090645714 11:128765202-128765224 CCTTGTAAGGAGAGGAGCCATGG - Intronic
1091112383 11:132981901-132981923 CCTTGTAAGGAGAAAAATGAAGG + Intronic
1092111953 12:5970403-5970425 CCTTGAAGGGAGATGAGAGATGG + Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1095342872 12:41112865-41112887 CCTTTTAAGGAGTTGCTGTAAGG + Intergenic
1095518919 12:43038590-43038612 CCATGGAAGGGGATGAAGGAGGG - Intergenic
1098921386 12:76305347-76305369 CCTTGTAAGTTGACAATGGATGG + Intergenic
1099864340 12:88260312-88260334 CCTTCCCAGGAGATCATGGAGGG - Intergenic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1105959468 13:25317197-25317219 CCTTTTGAGGAAATGATAGAAGG + Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1110979435 13:81876678-81876700 CCTTGTCAGGGGATGAGGAATGG + Intergenic
1112605311 13:100898882-100898904 TCTGGCAAGGATATGATGGAAGG + Intergenic
1114824973 14:26066057-26066079 CCTAGAAAGGAGATGAGAGATGG + Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1117114054 14:52491988-52492010 CCTGGGAAGGAAATGTTGGAAGG + Intronic
1117698325 14:58388879-58388901 CCTTTTAAGGAAATGGTGCAGGG + Intergenic
1119148193 14:72334789-72334811 CCCTGTGGGGAGATGCTGGAGGG - Intronic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1122160864 14:99782774-99782796 CCTGTGAAGGAGATGATGGGAGG + Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128270212 15:66302718-66302740 GCTTGAAAGGAGAAGATGGGAGG - Intronic
1128681294 15:69653808-69653830 GCTTGTAAGGAGAGCAGGGAAGG + Intergenic
1129719817 15:77871919-77871941 CCCTGTAAGGAGCTGGTGGCAGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1133868044 16:9661912-9661934 GCTTGTGAAGACATGATGGATGG - Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135883634 16:26283550-26283572 CCTTGAAATGAGATGGTTGAAGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1138753968 16:59459596-59459618 CCTGGGAAGCAGATTATGGAAGG + Intergenic
1140233443 16:73137459-73137481 CCTTCTAAGGAGATTAAGAACGG + Intronic
1141631468 16:85290277-85290299 CCTTGTGATGAGAAGATGGCAGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1144382944 17:14720782-14720804 CCTAGTAATGGGATGGTGGAAGG - Intergenic
1145013822 17:19384344-19384366 CCTTGTAAGGAGTTGGTGCTCGG + Exonic
1148812456 17:50302389-50302411 CCTTGGTAGAAGCTGATGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149102092 17:52919150-52919172 CCTTGGAAGGATTTGAAGGAGGG - Intergenic
1149121527 17:53172536-53172558 TATTGTAAGGAGGTGATGCAAGG + Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151550741 17:74821202-74821224 CCTTGCAAGGAGATGAGAGCAGG + Intronic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1155894066 18:31301336-31301358 CCTGGTGAGGAAATGCTGGAGGG + Intergenic
1160387512 18:78505468-78505490 CCTTGTCCTGAGATGAGGGAAGG + Intergenic
1160625611 18:80202359-80202381 CCTCCTAACAAGATGATGGAGGG + Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1166412389 19:42564577-42564599 CTTTGTATGGAGATCATTGAGGG + Intergenic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
925403802 2:3592233-3592255 CCGTGGAAGGAGACCATGGAGGG + Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG + Intergenic
931381575 2:61758316-61758338 CCATGTATTGAGATGAGGGAAGG - Intergenic
932004243 2:67912118-67912140 CCTAGTAAGGATTTCATGGATGG - Intergenic
932482296 2:72051714-72051736 CTCTGGAAGGAGGTGATGGAAGG - Intergenic
933774640 2:85764777-85764799 TCTTGTAAGTAGATGAGGGCAGG + Intronic
934514464 2:94977517-94977539 CCTTCTAAGGAAATGTTAGAAGG - Intergenic
935600540 2:104917629-104917651 CTTTGTAAGGAAGTGAGGGAAGG + Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937426353 2:121802504-121802526 ACCTTTAAAGAGATGATGGAGGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942584927 2:177465628-177465650 CCTTGTAGGGAGCTGATGCCTGG - Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1169912257 20:10656583-10656605 CCTTGTAAGGAGAGGAAGATGGG + Intronic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1171229839 20:23475490-23475512 CCTTGTTTGGAGATAACGGAGGG + Intergenic
1174170234 20:48613108-48613130 CCTTGTAAGGAGACACGGGAGGG + Intergenic
1175264407 20:57693837-57693859 CCTTGTGAGGAGGTGTTGGGTGG + Intronic
1175578829 20:60082959-60082981 ATATGTAAGGAGATTATGGAAGG + Intergenic
1184692586 22:46123952-46123974 CCTTGTCTGGAGGTGATGGGCGG + Intergenic
952195908 3:31075152-31075174 CCTAGTAAAGAGATGGTGGGGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
958698133 3:97553317-97553339 CCTTGTGAGGACATGAGGGAAGG - Intronic
962031026 3:131600404-131600426 ACTTGCAAGGAAATGATTGAAGG + Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968271069 3:197404200-197404222 CCGGGTAAGGAGATGAAGGAAGG + Intergenic
971294278 4:25375668-25375690 CCTGGGAAGTAGATGACGGAGGG - Intergenic
971541730 4:27826557-27826579 CCTTGAAAGGAGATGAGGGTGGG - Intergenic
972240462 4:37186360-37186382 AGTTATAAGGAGATGAGGGATGG + Intergenic
973028582 4:45306096-45306118 TATTGTAAGGAGAAGATTGAAGG + Intergenic
974282401 4:59814595-59814617 CCTAGTAAGAGGATAATGGAGGG + Intergenic
975844197 4:78507732-78507754 TCTGGAAAGGGGATGATGGAAGG - Intronic
976673352 4:87678100-87678122 CCCGGGAAGGAGATGAGGGAGGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978503955 4:109436728-109436750 CCTTCAAAGGGGATGATGGGTGG - Intronic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
982672104 4:158333363-158333385 CATGGGTAGGAGATGATGGAAGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
986488801 5:8268446-8268468 TCTTGTTAGGAGGTGATGTAAGG + Intergenic
990650977 5:57899196-57899218 CCTTTCAAGGAAATGATGAATGG + Intergenic
991090248 5:62687342-62687364 CCTTGTAATAAATTGATGGATGG - Intergenic
993090993 5:83426417-83426439 CCTTGTAAGAAGATAATAGTAGG - Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1004546050 6:16599209-16599231 CCTTGGAAGGCAATGATGGCTGG - Intronic
1006084553 6:31586873-31586895 GCTGGTAAGGGGATGATGGAGGG - Intronic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1007987336 6:46219914-46219936 TCTGGTAAGGATATGAAGGAAGG - Intergenic
1008165014 6:48126207-48126229 CCTTGTAGTGAGATGGGGGATGG - Intergenic
1008237171 6:49064463-49064485 CCTTGTCAGAAGTTGATGCAGGG - Intergenic
1009037770 6:58138729-58138751 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009213557 6:60892367-60892389 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1011528442 6:88292897-88292919 CCTTTTAAGGATAAGAAGGAAGG - Intergenic
1014392797 6:120884478-120884500 CCTAGTAAGGAGAATATCGAGGG + Intergenic
1016735753 6:147478019-147478041 TCTTGGCAGGAGATGATGAAAGG + Intergenic
1018742246 6:166738855-166738877 CATTGGCAGGAAATGATGGATGG - Intronic
1019088310 6:169502135-169502157 TCTGGTGAGGAGATGAGGGAGGG + Intronic
1021294576 7:18888678-18888700 CCATGTAAAGAGATGATAGGAGG - Intronic
1022628620 7:32064145-32064167 CCTTGCAAGGAGATGACCCAGGG - Intronic
1023153238 7:37222155-37222177 CCAAGGAAGGAGGTGATGGAAGG - Intronic
1024781437 7:52855308-52855330 CCCTTTAAGTAGATGATGCATGG - Intergenic
1025941906 7:66081242-66081264 CCCTCCAAGGAGATGATGGCAGG - Intronic
1026946772 7:74321212-74321234 TCCTGTAATGAGATGATGGATGG - Intronic
1029841594 7:103370354-103370376 CCTTGTGTGGGGATGAGGGAGGG - Intronic
1030478390 7:110068842-110068864 GCTTGTAAGGATATGAAGAAAGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037403366 8:18515854-18515876 CTTTGTGAGGAGATGAAGGCTGG + Intergenic
1037838687 8:22229367-22229389 GCTTGAAAGGAAACGATGGAAGG - Intronic
1037886084 8:22597229-22597251 CCTTGTCAGGAGTGCATGGACGG + Intronic
1038676737 8:29629708-29629730 CCTTGGAGAGGGATGATGGAAGG + Intergenic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1041431223 8:57782775-57782797 CCTTGTAAAGAGTTGCTGAATGG - Intergenic
1042046335 8:64656447-64656469 CGTGGTCAGGAGATGATTGAGGG - Intronic
1042046873 8:64663136-64663158 TCTAGCAAGGAGAGGATGGAGGG - Intronic
1043064824 8:75555453-75555475 TCTTGTAAGGAAAAGATGGGAGG - Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043997049 8:86830691-86830713 CCTAGAAAGGAGAGGATAGATGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1046507322 8:115152764-115152786 CCTTCTGAGGCGATGAGGGAGGG - Intergenic
1050060643 9:1705955-1705977 ACTTGAAATGAGATGCTGGATGG + Intergenic
1050282524 9:4066004-4066026 CATTTTAATGAGATGTTGGAAGG - Intronic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051725216 9:20081975-20081997 CCCTGAAAGGTGATGAGGGATGG - Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1055981434 9:82006405-82006427 CCTTGCAACAAGATGATGGGAGG - Intergenic
1060192874 9:121604072-121604094 CCTTGCAAGAAGGTGATGGTGGG + Intronic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1062111654 9:134785313-134785335 CCTTCCAAGGCGATGGTGGAGGG - Intronic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1188440761 X:30213885-30213907 CCCTGAATGAAGATGATGGAAGG + Intergenic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1190761635 X:53442192-53442214 CCTTGTAAGGATGTGAGGGCAGG - Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1194815340 X:98433920-98433942 CCTTGTCAGGAGATACTGCAGGG + Intergenic
1195759257 X:108228322-108228344 CCTTGAAAACAGATGATGCATGG + Intronic
1195786591 X:108530837-108530859 CCTAGTAATGGGATGATGGCTGG - Intronic
1198647287 X:138823157-138823179 CTTTGAGAGGAGATGATAGAGGG + Intronic
1199058594 X:143327486-143327508 CCTTGTGGGGAGTTGATGAATGG - Intergenic