ID: 1036543391

View in Genome Browser
Species Human (GRCh38)
Location 8:9741449-9741471
Sequence ACTGCTATAAAGACTGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036543391_1036543394 -9 Left 1036543391 8:9741449-9741471 CCTTTCACAGTCTTTATAGCAGT 0: 1
1: 0
2: 2
3: 13
4: 196
Right 1036543394 8:9741463-9741485 TATAGCAGTCACGGAGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036543391 Original CRISPR ACTGCTATAAAGACTGTGAA AGG (reversed) Intronic
901612992 1:10513795-10513817 GCTGCTATATTGACTGGGAAAGG + Intronic
902073532 1:13763433-13763455 ACAGTTATAAAGACTTTAAAGGG - Intronic
903257406 1:22112108-22112130 AGTGCTATATGGACTGGGAAGGG - Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
905427052 1:37894348-37894370 ACAGCAATCAAGACTGTGATGGG - Intronic
905505994 1:38480261-38480283 ACTGCCATGAAGACTGAGAAGGG - Intergenic
907288411 1:53396838-53396860 ACTGCTCAAAAGACTTTGAGTGG - Intergenic
907666523 1:56437941-56437963 AAAACTATAAGGACTGTGAAAGG + Intergenic
907930527 1:58995054-58995076 ACTGGTATAAAAACTTTAAAGGG + Intergenic
909885369 1:80935673-80935695 ACTTCTATGAAGACAGTGAATGG + Intergenic
913439903 1:118886256-118886278 ACTGGAATAAAGACTGTAAATGG + Intronic
915643519 1:157249511-157249533 ATTTCAGTAAAGACTGTGAATGG - Intergenic
915821907 1:159032767-159032789 ACTGCTGTAATCTCTGTGAATGG + Intronic
915922267 1:159985309-159985331 ACAGCTATAAATCCTGTGCACGG - Intergenic
918111394 1:181458066-181458088 ACTGCTATAAAGGCAGGAAAAGG - Intronic
918456778 1:184728500-184728522 ACTGCTATAAAATTTGTAAAAGG + Intronic
918787749 1:188786307-188786329 TCAGCTATAAAGACCCTGAAGGG + Intergenic
920918901 1:210281578-210281600 CCTGCTATAAAAACTGAGAAAGG - Intergenic
921876034 1:220197438-220197460 ATTCCTATAAAGCCAGTGAATGG - Intronic
924464974 1:244291525-244291547 AGTGCAATAAAGACACTGAATGG + Intergenic
1063399665 10:5730755-5730777 ACTGAGTTAAAGACTCTGAAGGG - Exonic
1063418420 10:5890997-5891019 ACTGCAATAAAAAATGTAAACGG - Intronic
1068075970 10:52254665-52254687 AATGCTAAAAAGTCTGTGAAGGG - Intronic
1068839858 10:61599248-61599270 ACTGTAATAAAGACAATGAATGG + Intergenic
1070373044 10:75803652-75803674 ACTGCTCTAAGGACTCTGCATGG - Intronic
1070639451 10:78157190-78157212 GCTGCTACACAGACTGTGAGAGG - Intergenic
1071036571 10:81254045-81254067 ACTGCTATTAAGAATGGCAAGGG + Intergenic
1071843410 10:89496876-89496898 ACTCCTATCAAGAATGTAAAAGG + Intronic
1075888482 10:125923843-125923865 ACAGATAGAAAGACTCTGAAAGG - Intronic
1076511712 10:131018970-131018992 AATGAGATAAAGAATGTGAAAGG + Intergenic
1080490243 11:32754795-32754817 AATGCTAAAAAGTCTGTTAATGG - Intronic
1081708825 11:45204085-45204107 ACTGCTAAAAAGACTGCCATCGG - Intronic
1081925040 11:46819324-46819346 ACTCCTATAAAGAAAGAGAAGGG + Intronic
1086451177 11:86918531-86918553 AATGCTATGAAGACAGAGAAGGG - Intronic
1086886333 11:92210248-92210270 CCTGCTATAAAGAGAGTAAAGGG - Intergenic
1087677163 11:101176204-101176226 CATTCTATAAAGACTGTTAAAGG - Intergenic
1089882664 11:121789847-121789869 AATGCTATAAGGACTCTGATTGG - Intergenic
1089941706 11:122424876-122424898 GCTGTTTTAAAGACTGGGAACGG - Intergenic
1090102732 11:123817486-123817508 ACTGCTATACAAATTATGAATGG + Intergenic
1090193815 11:124798883-124798905 GCTGCTAAAAAGATTGTGATAGG - Intronic
1093495904 12:19757374-19757396 GCTGTTATAAATACTATGAATGG + Intergenic
1096059684 12:48686223-48686245 CCTTGTATAAAGACAGTGAATGG - Intergenic
1096853350 12:54458121-54458143 AATGTTATAAAGGCTGAGAATGG - Intronic
1100764305 12:97846494-97846516 AGTGCTACTAATACTGTGAAAGG + Intergenic
1102268682 12:111511027-111511049 GTTGCTATAAAGAATGTGTAGGG - Intronic
1104154981 12:126122602-126122624 ACTTTTACAAAGACTCTGAAGGG - Intergenic
1104688689 12:130807765-130807787 ATTTCTATAAATACTGTGAAAGG + Intronic
1105220064 13:18317528-18317550 ACAGATAGAAAGACTCTGAAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105984589 13:25553035-25553057 ACTGATATTAAAGCTGTGAAGGG - Intronic
1108157200 13:47597531-47597553 ATTCCTATACAGACTGTGTAGGG - Intergenic
1108683071 13:52795860-52795882 ACTGATTTAAAGACTGGAAAAGG - Intergenic
1109910070 13:68898000-68898022 AAGACTAGAAAGACTGTGAAAGG - Intergenic
1114625593 14:24127555-24127577 AATACTATAAAGACTGAGAGTGG - Intronic
1114868520 14:26628062-26628084 AATCCTATAAAGACAGTAAAAGG + Intergenic
1115584395 14:34795996-34796018 AATACTATAAAGACTGAAAATGG + Intronic
1119275113 14:73348377-73348399 TCTGCTTTAGAGACTGTGCAGGG - Intronic
1124165019 15:27318690-27318712 ACAGCTAGAAACAGTGTGAAGGG - Intronic
1130144447 15:81263051-81263073 CTTGCTATAATGATTGTGAAAGG + Intronic
1130944269 15:88539164-88539186 ACTGTTATAAACTCTGTGAATGG + Intronic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1133777340 16:8907348-8907370 ACCACGGTAAAGACTGTGAATGG + Intronic
1135102416 16:19617694-19617716 ACTGTCATGAAGACTGTGATAGG + Intronic
1137279641 16:46964764-46964786 ACCGCTGTAAAAAATGTGAAGGG - Exonic
1138868821 16:60855522-60855544 AATGCTATTAAGACTATGTAAGG + Intergenic
1138873386 16:60920196-60920218 ACTGCTATAAAGACACTCCATGG + Intergenic
1139615593 16:68087040-68087062 ACTACTAGGAAGTCTGTGAATGG + Intronic
1140175412 16:72654442-72654464 ACTGGGATAAAGAGTGAGAAGGG + Intergenic
1141349552 16:83281336-83281358 AGTGCTATAAAGGCTGAGAGAGG - Intronic
1142943723 17:3406642-3406664 AATGCTATGAAGAATGTCAATGG + Intergenic
1144551190 17:16242337-16242359 AGTTCTATATAGACTGGGAATGG - Intronic
1155102400 18:22624968-22624990 ATTGCTACAAAGACTGTGATAGG + Intergenic
1155920473 18:31598367-31598389 CCTGCTCTAAGGACTGTGCATGG + Intronic
1158936113 18:62366116-62366138 ACTGATTTAAAGGCTATGAAGGG - Intronic
1159357979 18:67360595-67360617 ACTTTCATAAACACTGTGAAAGG - Intergenic
1167223738 19:48221990-48222012 ACTGATATAAAGATTGTGATAGG + Intronic
932508757 2:72263949-72263971 AATGCTATGAAGATTCTGAAAGG + Intronic
932859875 2:75279036-75279058 ACAGTTATAAATGCTGTGAATGG - Intergenic
933331149 2:80894831-80894853 GCTGCAATAAACACTGTGAGAGG - Intergenic
934183981 2:89654961-89654983 ACAGATAGAAAGACTCTGAAAGG - Intergenic
934294272 2:91729126-91729148 ACAGATAGAAAGACTCTGAAAGG - Intergenic
935173007 2:100625251-100625273 ACTGCCACAAAGCCTCTGAACGG + Intergenic
935335000 2:102007999-102008021 ACTGATGGAAGGACTGTGAAAGG - Intronic
936848599 2:116868835-116868857 AATTCTGTAAAGACTGTCAATGG + Intergenic
937586586 2:123558860-123558882 AATGCTATAAAAACTCTGGAAGG - Intergenic
938650695 2:133380207-133380229 ACTGTTATAAACAGTTTGAATGG - Intronic
939043245 2:137217585-137217607 ACTGCTATGAATACTGCTAAAGG - Intronic
939443477 2:142278752-142278774 AATTTTATAAAGACAGTGAAGGG + Intergenic
940142157 2:150503985-150504007 ACTGATATTAAGACTCAGAAAGG + Intronic
940549166 2:155130028-155130050 ACTGCTATAAAACCTGAGACTGG - Intergenic
941140435 2:161774090-161774112 CCTGCAATAAAAACGGTGAAGGG + Intronic
941276382 2:163496026-163496048 AATTCTATGAAGACTGTCAATGG - Intergenic
1175562489 20:59941935-59941957 ACTACTATAAATACTGTGAATGG - Intronic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
951804511 3:26629835-26629857 TCTGCTACAAAACCTGTGAAAGG + Intronic
953012222 3:39037951-39037973 AATGCTAAAAAGATTGTTAAAGG + Intergenic
955341440 3:58128514-58128536 ACTGCTATGAAGAATGAGAATGG + Intronic
956375179 3:68606663-68606685 AATTCTGTAAAGAATGTGAATGG - Intergenic
957215325 3:77313532-77313554 ACTGATCTAGAGACTGGGAATGG - Intronic
957855504 3:85871377-85871399 TCTGTTAGAAAAACTGTGAATGG - Intronic
960628925 3:119708653-119708675 ATCGCTATAAATACTTTGAAAGG + Exonic
961703945 3:128769247-128769269 ACTGCTGGTAAGAATGTGAAAGG - Intronic
963007470 3:140739414-140739436 ACTGCATTTAAGACTGAGAAGGG + Intergenic
964061470 3:152529756-152529778 AATTCTATCAAGACTGTGAGTGG - Intergenic
965372841 3:167885783-167885805 AATGCTAAAAGGCCTGTGAATGG + Intergenic
965458932 3:168937225-168937247 AATTCTATAAAGACTGAGAGAGG - Intergenic
967425484 3:189322467-189322489 ACTTCTATTCAGACTGTAAAAGG + Exonic
969054189 4:4391274-4391296 ACTGCTATCAGGATTATGAATGG + Intronic
970284843 4:14500393-14500415 AATTCTGTAAAGACTGAGAAAGG - Intergenic
970825285 4:20265433-20265455 ACTGCTTTAAAGACAATAAAAGG + Intronic
974411170 4:61542625-61542647 ACTGCTATAAACACTTTCAAAGG - Intronic
975594643 4:76038010-76038032 ACTACTGTAAAGACTTTCAAAGG - Intronic
976683261 4:87781499-87781521 ACTGATATAAAAACTCTGAGTGG - Intergenic
977795000 4:101154194-101154216 AATGCTTCAAAAACTGTGAATGG + Intronic
979974105 4:127174563-127174585 ACTACTATGAAGAATGTCAAAGG - Intergenic
979976951 4:127208657-127208679 ATTTCTATGAAGACTGTCAATGG + Intergenic
980029461 4:127810266-127810288 ACTGCTTTATAGACTAAGAAGGG + Intronic
981326751 4:143456888-143456910 ACTGCTGAAAAGCCTATGAAAGG - Intronic
981439312 4:144765034-144765056 AATGCTATAAGGGCTGAGAAAGG - Intergenic
981458226 4:144981178-144981200 AATTCTATAAAGAATGTCAATGG + Intronic
983202616 4:164878497-164878519 ACTGCTGTAAACAATGAGAAGGG - Intronic
983402701 4:167285487-167285509 AATTCTATGAAGAATGTGAATGG + Intergenic
984043081 4:174761726-174761748 ACTACTATGGAGACTGTGAGGGG + Intronic
984094286 4:175414194-175414216 ACTCCTATAAAAACTGGAAAAGG + Intergenic
984504706 4:180602518-180602540 AATGTTATAAAGTATGTGAAAGG + Intergenic
986022307 5:3815886-3815908 ACTGCTTAATAGATTGTGAAAGG - Intergenic
986448280 5:7842244-7842266 AATGCTTTAAATACTCTGAAAGG - Intronic
987284717 5:16444405-16444427 AGTACTTTAAAGAGTGTGAAAGG + Intergenic
988558968 5:32263112-32263134 AAGGCTATAAAGTCTGTGAGAGG - Exonic
990408539 5:55516942-55516964 TCTGCAATAAAGAATGTAAATGG - Intronic
990885972 5:60593899-60593921 AATTCTATAAAGACTGAGAGAGG + Intergenic
991984918 5:72275495-72275517 AATGCTGTAAAGAATGTCAATGG - Intronic
993654499 5:90560843-90560865 ACTGCTAGAAAAAATGTGAGAGG + Intronic
993790457 5:92202345-92202367 ACTGCTAGACAGAATGTAAATGG - Intergenic
995623623 5:114054594-114054616 ACTGCTCTAATAACTGTGGAAGG - Intergenic
995690787 5:114824258-114824280 ACTGCTATAAAGAACGAGACTGG + Intergenic
996468255 5:123828484-123828506 ACTGCTATATAGACTAAGCAAGG + Intergenic
996806811 5:127464686-127464708 ACTGCTGTGAAGAATGTCAATGG + Intronic
997591859 5:135078761-135078783 ATGGCTATAAAAACTGTAAATGG - Intronic
999814993 5:155167161-155167183 ACTGTTTAAAATACTGTGAAAGG + Intergenic
1001360324 5:171077908-171077930 ACTTCTATGAAGACTGAGAGAGG + Intronic
1004408192 6:15354814-15354836 AATGCTGTAAAGAATGTTAAAGG + Intronic
1007536817 6:42598645-42598667 ACTCCTATAAAGACTAACAAAGG - Intronic
1008724393 6:54399184-54399206 AATGCTAAAAAGATTGTAAATGG - Intergenic
1008975084 6:57416824-57416846 AATTCTATAAAGGCTGAGAAAGG - Intronic
1009163971 6:60318341-60318363 AATTCTATAAAGGCTGAGAAAGG - Intergenic
1009821256 6:68804137-68804159 GATTCTATTAAGACTGTGAAGGG - Intronic
1010336848 6:74695271-74695293 ACTGCTAAACACACTCTGAAGGG - Intergenic
1011060717 6:83263652-83263674 AATTCTATAAAGGCTGAGAAAGG + Intronic
1011411461 6:87070856-87070878 ACTGGCATAAAGGCTCTGAAAGG + Intergenic
1013153868 6:107474485-107474507 ACTCCTATACAGGCTATGAAGGG + Intergenic
1013360845 6:109392641-109392663 TCTGTCATAGAGACTGTGAAAGG - Intronic
1013402192 6:109809503-109809525 AATGCTTTTAAGAGTGTGAAGGG + Intronic
1014337625 6:120157236-120157258 AGTGTTATAAAGACTGAGAGAGG - Intergenic
1015698735 6:136011204-136011226 TCTGCTATAAAGAAAGGGAAAGG - Intronic
1015738937 6:136432526-136432548 AATTCTAAAAAGAATGTGAAAGG + Intronic
1016646947 6:146421201-146421223 ACTGCAATAAACATTGTTAATGG - Intronic
1016892491 6:149020573-149020595 ATTGTTGTAAAGACTGTGCAAGG - Intronic
1017310825 6:152975449-152975471 ACTGCATTAAAGACTATGAAAGG - Exonic
1017564858 6:155672550-155672572 ACTGTTTTAAATACTGTGAGTGG - Intergenic
1018063650 6:160110065-160110087 TCTCCTTTAAAGACTCTGAAAGG - Intronic
1019679488 7:2338022-2338044 AGTGTAATAAAGACTGCGAAAGG + Intronic
1020775544 7:12450049-12450071 ATTGCTATAAAGACAGGTAAAGG + Intergenic
1029213902 7:98931308-98931330 TCTGCCATAAAGACTGTCACTGG - Intronic
1030560368 7:111077496-111077518 AGACCTATAAAGACTGTTAATGG - Intronic
1030653465 7:112140711-112140733 GCTGCTATAAAGAGGCTGAAAGG - Intronic
1032519066 7:132528958-132528980 GCTGCCATGAAGACTATGAAGGG + Intronic
1033639183 7:143244421-143244443 AGTGTCATAAAGCCTGTGAATGG - Intronic
1033786589 7:144738578-144738600 ATTGCTATCAAGAAAGTGAAAGG - Intronic
1033807050 7:144966228-144966250 GGAGCTATAGAGACTGTGAAGGG + Intergenic
1036543391 8:9741449-9741471 ACTGCTATAAAGACTGTGAAAGG - Intronic
1036543399 8:9741579-9741601 ACAGCTATAAAGACTGTGCAAGG - Intronic
1036957462 8:13203958-13203980 AATGCTATGAAGTCTGTGCATGG - Intronic
1037531764 8:19783070-19783092 AATTCTGTAAAGACTGTCAATGG - Intergenic
1037553860 8:20003590-20003612 AATTTTATATAGACTGTGAATGG + Intergenic
1038296287 8:26293084-26293106 GCTGCTAAAGAGACTGTCAAAGG - Intronic
1038949596 8:32400003-32400025 ACTGCTATAAAGACCCTCATGGG - Intronic
1039152523 8:34522706-34522728 ACTGTTATAAAGATTTTCAAAGG + Intergenic
1039189793 8:34960359-34960381 ATGGCTATACAGACTGTGCAAGG + Intergenic
1042631353 8:70820552-70820574 ACTGCTATAAAGACTGCTTGAGG + Intergenic
1042980768 8:74525224-74525246 ACTTCTATAAAGAGTGTAATTGG - Intergenic
1043238339 8:77898767-77898789 AATGCTATGAAGTCTGAGAAAGG - Intergenic
1043590425 8:81826148-81826170 ATTGCCAGAAAGACAGTGAAAGG + Intronic
1050128790 9:2387902-2387924 ACAGCTATACAGACTGTAATGGG - Intergenic
1050181188 9:2924420-2924442 ACTGCAATATAGACTGTGCCTGG + Intergenic
1051080158 9:13284744-13284766 ATTGCTATAAAGATTTTTAAAGG + Intergenic
1051434426 9:17016149-17016171 ACTGCTATAAACCCTCTGGAAGG + Intergenic
1052271028 9:26628108-26628130 ACTGGAAGAAAGACAGTGAATGG - Intergenic
1052642824 9:31191502-31191524 CCTGCTAAAAAGACTGTTTAGGG + Intergenic
1055534442 9:77223619-77223641 AATACTATAAAGACTGAGAGAGG + Intronic
1055592176 9:77828486-77828508 TGTGCTGTGAAGACTGTGAATGG - Intronic
1055697847 9:78906933-78906955 ACATCTATGAAAACTGTGAATGG - Intergenic
1057786802 9:98094042-98094064 ACTGCTATAAAGAATAATAAAGG - Intronic
1060250762 9:121985261-121985283 AATGAGATAAAGATTGTGAATGG - Intronic
1060399380 9:123339340-123339362 ACAGCTATAAATACTCTGACGGG - Intergenic
1203734782 Un_GL000216v2:126300-126322 ACAGATAGAAAGACTCTGAAAGG - Intergenic
1186057702 X:5667503-5667525 CCTGCTACAAAGCCTCTGAATGG + Intergenic
1186172819 X:6895630-6895652 ACTCATATAAACACTGTGAAGGG + Intergenic
1190115748 X:47625466-47625488 CCTGGCATCAAGACTGTGAACGG - Intronic
1192966053 X:76178085-76178107 ACTGGTCTAAAGACTGTTAGTGG + Exonic
1193615182 X:83678813-83678835 AATTCTATGAAGACTGGGAAAGG - Intergenic
1194278026 X:91911809-91911831 ACTTCTATAAAGAATGTCATTGG + Intronic
1194355826 X:92882527-92882549 ACTTCTATAAAGAATGTTATTGG - Intergenic
1196326525 X:114411804-114411826 CCTGCTATTAACAATGTGAAGGG - Intergenic
1198620268 X:138500149-138500171 ACTGCTAAAAACATTATGAATGG - Intergenic
1198818887 X:140624145-140624167 AATTCTATAAAGACTGAGAGAGG + Intergenic
1200595363 Y:5133882-5133904 ACTTCTATAAAGAATGTCATTGG + Intronic
1200640913 Y:5716698-5716720 ATTGCTATAAAGAATGTCATTGG - Intronic
1200664173 Y:5999508-5999530 ACTTCTATAAAGAATGTTATTGG - Intergenic
1201522543 Y:14892011-14892033 ACTGCAATAAATATTGAGAATGG - Intergenic
1202131285 Y:21613491-21613513 AGTGCCATAAAAACTGAGAAAGG - Intergenic
1202626249 Y:56862229-56862251 ACAGATAGAAAGACTCTGAAAGG + Intergenic