ID: 1036549653

View in Genome Browser
Species Human (GRCh38)
Location 8:9805165-9805187
Sequence TGAAGGAGCCCCGGGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549653_1036549662 26 Left 1036549653 8:9805165-9805187 CCACAGCTCCCGGGGCTCCTTCA No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549653_1036549661 25 Left 1036549653 8:9805165-9805187 CCACAGCTCCCGGGGCTCCTTCA No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549653_1036549660 18 Left 1036549653 8:9805165-9805187 CCACAGCTCCCGGGGCTCCTTCA No data
Right 1036549660 8:9805206-9805228 TGCTTCAGATGCCAAAAGCCTGG No data
1036549653_1036549656 -9 Left 1036549653 8:9805165-9805187 CCACAGCTCCCGGGGCTCCTTCA No data
Right 1036549656 8:9805179-9805201 GCTCCTTCAAAACTTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549653 Original CRISPR TGAAGGAGCCCCGGGAGCTG TGG (reversed) Intergenic
No off target data available for this crispr