ID: 1036549655

View in Genome Browser
Species Human (GRCh38)
Location 8:9805174-9805196
Sequence AGGAAGTTTTGAAGGAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549655_1036549662 17 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549655_1036549664 24 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549655_1036549660 9 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549660 8:9805206-9805228 TGCTTCAGATGCCAAAAGCCTGG No data
1036549655_1036549661 16 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549655 Original CRISPR AGGAAGTTTTGAAGGAGCCC CGG (reversed) Intergenic
No off target data available for this crispr