ID: 1036549657

View in Genome Browser
Species Human (GRCh38)
Location 8:9805182-9805204
Sequence GGTCCACGAGGAAGTTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549657_1036549661 8 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549657_1036549660 1 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549660 8:9805206-9805228 TGCTTCAGATGCCAAAAGCCTGG No data
1036549657_1036549662 9 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549657_1036549664 16 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549657 Original CRISPR GGTCCACGAGGAAGTTTTGA AGG (reversed) Intergenic
No off target data available for this crispr