ID: 1036549658

View in Genome Browser
Species Human (GRCh38)
Location 8:9805194-9805216
Sequence CATCTGAAGCAAGGTCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549658_1036549664 4 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549658_1036549662 -3 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549658_1036549661 -4 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549658_1036549667 19 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549658 Original CRISPR CATCTGAAGCAAGGTCCACG AGG (reversed) Intergenic
No off target data available for this crispr