ID: 1036549659

View in Genome Browser
Species Human (GRCh38)
Location 8:9805203-9805225
Sequence GGCTTTTGGCATCTGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549659_1036549664 -5 Left 1036549659 8:9805203-9805225 CCTTGCTTCAGATGCCAAAAGCC No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549659_1036549667 10 Left 1036549659 8:9805203-9805225 CCTTGCTTCAGATGCCAAAAGCC No data
Right 1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549659 Original CRISPR GGCTTTTGGCATCTGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr